Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05H10.6   

sjj_T05H10.6RNAiJA:T05H10.6
PCR_productsjj_T05H10.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T05H10.5 Source_evidenceePCR1032WS150 Sequence/Annotation Release
Chunk_score Abs_score969
Max_abs_score969T05H10.5
Specificity_index0.5
Rel_score1
Map_statusBest_ePCRII80665308067691
T05H10.6 Source_evidenceePCR1032WS150 Sequence/Annotation Release
Chunk_score Abs_score969
Max_abs_score969T05H10.6
Specificity_index0.5
Map_statusBest_ePCRII80665308067691
Overlaps_transcript (7)
WB_DNA_textsjj_T05H10.61162tggaccaaacacctctgtcaccttgaacagagaagatgctctcaagtactaccgtgacatgcaggtcattcgtcgcatggagtctgctgctggaaacttgtacaaggagaagaaaatccgcggtttctgtcatctctactctggtcaagaagcttgtgccgtcggaatgaaggctgcaatgacagaaggagatgccgtcatcactgcttaccgttgtcacggatggacctggcttcttggagctaccgtaaccgaggttcttgctgaattgaccggtagagttgccggaaatgttcacggaaaaggaggatccatgcatatgtacacaaagaatttctatggaggaaacggaattgttggagcacaacagccacttggagctggagttgcattggccatgaaataccggtatgttaacaaattttgatgtatttttttacgagaacaactcatattttttcatctaaatattttattttattttcagtgaacaaaagaatgtatgtgttactttgtatggtgatggtgccgctaatcaaggacaacttttcgaggcgactaacatggctaaactttgggatcttcctgttctgttcgtttgcgaaaacaatggattcggaatgggaactactgctgaacgttcatctgcttctaccgagtattatactagaggagactatgttcctggaatctgggttgatggtatggacattctcgctgttcgcgaggctaccaagtgggctaaggaatattgtgacagtggtaaaggaccacttatgatggaaatggccacctatagataccatggacactctatgtctgacccaggaaccagctaccgtacccgtgaagagattcaagaagttcgtaaaacaagagacccaattactggattcaaggaccgtatcattacatcttcattggccacagaggaagaacttaaggctattgacaaggaagttcgcaaagaggtcgatgaagcgttgaagattgctacatcagacggtgttctcccaccagaagctctctacgccgatatttatcacaacaccccagctcaagaggtaagtaataacattcattattttttcgtcaattattgttcacattttcagattcgcggagccactattgatgaaactatcgtccagccattcaaaac