Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05H4.4   

sjj_T05H4.4 RNAi JA:T05H4.4
Simmer:T05H4.4:Repeat_a
Simmer:T05H4.4:Repeat_b
Simmer:T05H4.4:Screen
PCR_productsjj_T05H4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05H4.4 Source_evidenceePCR912WS150 Sequence/Annotation Release
Overlaps_Gene T05H4.4 Source_evidenceePCR912WS150 Sequence/Annotation Release
Chunk_score Abs_score807
Max_abs_score807T05H4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV64413416442660
Overlaps_transcriptT05H4.4 Source_evidenceePCR912WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05H4.41320cgcctttcagtagttgtccatacagctgcgaaacaataataattccaaatgagttggttattttaatattatatcccgattaggagacgaaaaaacaaagtatttttttctgattcttttcttttcgaccttttaaatcgaaaattaattaatattttaggccatttcaatctcgacactttttttgaaatggttgagaacaatacacttgcgataactggaggcgtggtacttatttcaagtgtttctctatttttgtatttgagacaactcagggctgaaaaagtgagtcttccattctttttatttcctaatacaaaaaagtttagaaatcaaaaagaacgcttgaagacgattcggtcaaatatttgcttcctctcatagaaaagttcgagatcagtcacaatacgagaaaattccgattcggattaccatcgaaggatcatattctaggacttcccattggacatcatgtgtatcttagtgccaatgtatgttttcttcagatgatataattaattattttaaaataatttccagattggtggaaagcttatagttcgatcctataccccagtgtcttgtgacttagacttgggatatgtagatttgatggttaaagtgtattttaagaatacacatgaaagattcccggatggtgggaaaatgagccaacatttggagagcctcaagattggagatactgtaggtgatttctgatttggtaaaaaaaaattaaaccatgtataggttagcttccgtggtccacatggaagcataatttataagggaagtggtctattcactgtacgaatggataagaaggccgagccaaagaatcgatttttcaagcatctttccatgattgctggaggtaccggaatcacaccgatgcttcaagtcattgccgccattcttcgtgatccaattgacgctactcagatcagacttctgtttgcaaatcagaccgaagacgatattctgtgcaggaaagagctcgacgagctagccgagaagcatccaactcgtttccgtgtatggtatactgtaagcaaagcgtcaaaagattggagatattctacagggcatataaatgaggaaatgatcaaggtgagttacaggtatttctagataattttttcgacccattttttgtttcaggaacatctattcccttccaatgaggaatctgctgtgctgttgtgtggaccaccagcaatgatcaactgtgcgtgcattccaaatcttgataagcttggacacaattcagaaaattaccttatattctagtttcttattcaactttctcattgttttgca