Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T06D8.8   

sjj_T06D8.8 RNAi (3)
PCR_productsjj_T06D8.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T06D8.8 Source_evidenceePCR886WS150 Sequence/Annotation Release
Chunk_score Abs_score828
Max_abs_score828T06D8.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1123801711239059
Overlaps_transcript T06D8.8.1 Source_evidenceePCR886WS150 Sequence/Annotation Release
T06D8.8.2 Source_evidenceePCR712WS150 Sequence/Annotation Release
WB_DNA_textsjj_T06D8.81043gagttccttcgagcgatttgaggatggggtgagcaagctgaaaaaaccgtttattgggggaatttaaattgagagtttcaacaaaccaattctccgaagttgtgcacgttttctcccagaagagcagcgaaaccgagaagaaccgcatggacttgcttctgttctgttgtcagattattggcgtcctcaactccaagataacgaagagcttcgcgataatatccagcgaagtctccaacttcacgaagatataaagatgagacgcggtagaacggggcatgaacttctgtaactccgacaagtgagtccacttcgtgttgtgtcgaatcgatttgagttcgaatgctcttcagatcaataatctgtccatttttgtccttgttctccagtctggcttcaatctctccggtatgaagtcgagcaacggcaatcttgtccttgttgatgacgtttccaatttttgacaggaattccatagatttttgcttgtcctttgtcgcgatattttgggcgatcgaaatgcaaatctcgacgagctgaagagggttgacacgcagctcccactccgccacgaacagtctgtagaattcgtgcatgtccgttgaagccacaaattgtggcttcttcacaagggatcgtgtcagaaccgttagttgatgccagagcctgaaaattagtgaaatagtttgtgtctacaaaaacaattgattcttactttttctcccagagctccttgagattcttccagtcatcggccagaggtccattggcagccgccagctttccgttgaggtagtcttgagcagtcatcctgagaaattctcgatacattaaaaattgagacgagaaatgagtgaagaagaaagaaaatgaaggagtaggagcaatcaaaacaaaaatggatttcgaatagctaaaatgaacatttttggcgagcgcgctctcacaaaaatcaaaacaaaaaactttttttgaattttatttgtcagcaattaaaggcgcatggcctttcactttggaaatatcgagacgcgaaagacaat