Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T06D8.8   

sjj_T06D8.8 RNAi JA:T06D8.8
Simmer:T06D8.8
PF:GL1_7C12
PCR_productsjj_T06D8.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T06D8.8 (3)
Overlaps_transcript T06D8.8.1 Source_evidenceePCR886WS150 Sequence/Annotation Release
T06D8.8.2 Source_evidenceePCR712WS150 Sequence/Annotation Release
WB_DNA_textsjj_T06D8.81043gagttccttcgagcgatttgaggatggggtgagcaagctgaaaaaaccgtttattgggggaatttaaattgagagtttcaacaaaccaattctccgaagttgtgcacgttttctcccagaagagcagcgaaaccgagaagaaccgcatggacttgcttctgttctgttgtcagattattggcgtcctcaactccaagataacgaagagcttcgcgataatatccagcgaagtctccaacttcacgaagatataaagatgagacgcggtagaacggggcatgaacttctgtaactccgacaagtgagtccacttcgtgttgtgtcgaatcgatttgagttcgaatgctcttcagatcaataatctgtccatttttgtccttgttctccagtctggcttcaatctctccggtatgaagtcgagcaacggcaatcttgtccttgttgatgacgtttccaatttttgacaggaattccatagatttttgcttgtcctttgtcgcgatattttgggcgatcgaaatgcaaatctcgacgagctgaagagggttgacacgcagctcccactccgccacgaacagtctgtagaattcgtgcatgtccgttgaagccacaaattgtggcttcttcacaagggatcgtgtcagaaccgttagttgatgccagagcctgaaaattagtgaaatagtttgtgtctacaaaaacaattgattcttactttttctcccagagctccttgagattcttccagtcatcggccagaggtccattggcagccgccagctttccgttgaggtagtcttgagcagtcatcctgagaaattctcgatacattaaaaattgagacgagaaatgagtgaagaagaaagaaaatgaaggagtaggagcaatcaaaacaaaaatggatttcgaatagctaaaatgaacatttttggcgagcgcgctctcacaaaaatcaaaacaaaaaactttttttgaattttatttgtcagcaattaaaggcgcatggcctttcactttggaaatatcgagacgcgaaagacaat