Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T06G6.3   

sjj_T06G6.3RNAiJA:T06G6.3
PCR_productsjj_T06G6.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T06G6.3a Source_evidenceePCR814WS150 Sequence/Annotation Release
T06G6.3b Source_evidenceePCR814WS150 Sequence/Annotation Release
Overlaps_Gene T06G6.3 Source_evidenceePCR814WS150 Sequence/Annotation Release
Chunk_score Abs_score667
Max_abs_score667T06G6.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1270915712710335
Overlaps_transcript T06G6.3a Source_evidenceePCR814WS150 Sequence/Annotation Release
T06G6.3b Source_evidenceePCR814WS150 Sequence/Annotation Release
WB_DNA_textsjj_T06G6.31179ccaactcaaagccttgcttcatcgaatcgacttgctcattcaactttagatgttcctccatccagcgctgcaatatctcatgtcttatttttttaacatgcatagctattcctaccgtatcagcaaaccgcagtcctctgattgtgttttggagatcgcatatatccacatactgcttgcaattctcgtcctgaaaatttcaataaaaactcacggttccaaaataaaaatacaactcaccataagattttgctctcgaatcgtcgagtcggatttccaggtctgtaagctctccagctcctcggaatttttgaggatgagctgttcgagcttctgaaaaagataccttgatggtttgaagaagtgttagtcatgtcttaccttgatttccgattgagcttcattcaggatagcactttgatagttgagctgattggttgttacctggtaaaacaaatatttacggtaatgaacagcaaaatctaggaactttttatgtaagctctcataaggaagcttctggaatgacattgttagcctataagctcaataacctaaaaccccacttaccaaatgatcgtcctgctcctttttgagctttgcctccaggctgctaaggatctccttgtttgaagactgttcctcgctcttgcttgatgctggatgctctttggcccgggccttattgctggcctgaaagcttggattgtagcttagctagttagaactagcccaccttgaattcaagcgcttggtccaaaatctgctgcgccagtttgcacatatcgttttgatgctctttttcctttactttccattctccaatcaacttttcaatttccttcttctgtttacgaagttggcggtgacggatctcctgaaaacacatcaaattggttacggggttttctctataattccccttactgtatgcgcatccctctcatagtccagcacagaattcaaaagttctgcatgatccattgcttcctgagcaatcagggaagccttctctctgatagaatccatgtactccaactttttcagaggatcctgctccgcgtctagttgcttgttaagctcacgaatctcattttgagctactttgattctttcagacttgattatctgaattgggcaggtttcgtcaagcttgaagtggttgacattccttttgca