Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07C4.4   

sjj_T07C4.4RNAiJA:T07C4.4
PCR_productsjj_T07C4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T07C4.3 Source_evidenceePCR340WS150 Sequence/Annotation Release
Chunk_score Abs_score319
Specificity_index0.401
Rel_score0.669
Map_statusTop50_percentile_ePCRIII1035464010355640
T07C4.4 Source_evidenceePCR498WS150 Sequence/Annotation Release
Chunk_score Abs_score477
Max_abs_score477T07C4.4
Specificity_index0.599
Rel_score1
Map_statusBest_ePCRIII1035464010355640
Overlaps_transcript T07C4.3b Source_evidenceePCR340WS150 Sequence/Annotation Release
T07C4.4.2 Source_evidenceePCR351WS150 Sequence/Annotation Release
T07C4.4.1 Source_evidenceePCR498WS150 Sequence/Annotation Release
WB_DNA_textsjj_T07C4.41001acttcacctccacatctcacaatcactcctcacatccacgtgtcatagtgcttaattggtgctattaaatcgccgctgtaaattatcagtcctcaccacactctatattttatccagataactttcttttgtatgtgtgtgtgtgtttcgagacaattatattctaatttctaattttataccccctcccttctaccgtgtgtggttttctagtttacgtgttctcagggtagctgagaacttttcccccattcaacaactagaaccaacacgagttctaattttaataactctaaaattccacgcgcacaaaccaatttcgccgttgtttctgtttttgttaaatgaaagaatattttgatgattttgaaggaaacatttattattcttagcacaaatcaacatccttgcacgccttgtctggagaatccttgttctcaatatcctttttcagctccttcttgaccttcttcagctcttcctcacactcgtgatgcaacggcaacagcatagtccagcaaagagttccgatgttcacatcaagccatgcatcgagatcatcatctccaaccttctctccaccctgaaatatgtgaataacgaggaaaattggagatatttggagcacaaacctcgacgagagccttgcagacatcacagaaaacaccgtgatgcttcttgagattgagtgggttagctggattggctagaagtggagcagcggcgagcaagacaaggaaaagacacggaagaatgcgagtcattctgtagattttaagatgaaaaactggagaaatgaagcgaaaatgcacccggagcagtgatgctcgtgtcttttatcaacttcgcggcggcactgataaggaatcgaatcgtttctgatgttttcagcatggaggaaaagatcaaaggacattatagaatacacaccgggtcgttcacacatcagatgccgatttttcgaactgataagatcgcttagaggagtagcttttcgcctt