Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07C4.7   

sjj_T07C4.7 RNAi JA:T07C4.7
Simmer:T07C4.7
PCR_productsjj_T07C4.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T07C4.7 Source_evidenceePCR663WS150 Sequence/Annotation Release
Chunk_score Abs_score600
Max_abs_score600T07C4.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1033414210334979
Overlaps_transcript T07C4.7.2 Source_evidenceePCR618WS150 Sequence/Annotation Release
T07C4.7.1 Source_evidenceePCR663WS150 Sequence/Annotation Release
WB_DNA_textsjj_T07C4.7838agaaaatcagcattgtttcaggatgattaacattccaactgcgattctgtgccgcttgggcgccagatcgtcgatttcccgctcctttggaacatcgatcgtcaccaaggtggggattttttgaatttttccgtgaaaattgttgattttttgtgtacgcatgaaggagaaatgtataacagacacattcttttcaattaattatttataatattcacagtccgaggcaaagacgccaatccagaagttcggatgggaatacctgttgaagcagcgctccaagaatcgcccaatcgctccacatctcaccgtctaccagccacaattgacctggatgctctccggattccatagaatcagcggttgtgtaatggccggaacccttctcgtcggaggaatcggattcgcagttttgccgttcgatttcaccgcttttgtggatttcatccgtagctggaacttaccatgcgcggtgaccgctgtcttcaagtacatcattgctttccccatcattttccatactcttaacggaattcgcttcttaggattcgatttggctaagggagtcaataatgttggacaggtaggagttgaaattattaatttaattgttttaaaataaaaattaattttcagatctacaaatcgggatatctcgtatctggactttcggctattcttgctctcgccattgtcttcaactcttgccagaacaagagcaacaagactgcctaggcacagatgctccgccttcttttttcttactccgccccagccctcgacaattctcgtcaatttacttttaccgttgatttcttcgattttctctcttttccgt