Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07F8.1   

sjj_T07F8.1 RNAi JA:T07F8.1
[cgc5655]:T07F8.1
PCR_productsjj_T07F8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST07F8.1 Source_evidenceePCR1023WS150 Sequence/Annotation Release
Overlaps_Gene T07F8.1 Source_evidenceePCR1023WS150 Sequence/Annotation Release
Chunk_score Abs_score1002
Max_abs_score1002T07F8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII71494297150451
Overlaps_transcriptT07F8.1 Source_evidenceePCR1023WS150 Sequence/Annotation Release
WB_DNA_textsjj_T07F8.11023aggcgaaatagaattcgaaaaacgatctcacagtgatacgaaaaagaagttgggaaagtttgcggatgaaactttcgtaaaggaagaaaagctcgaaagaattaatgaggaaatgagtgaaaatttgagaaaactggcactaaaaccagcgtcagaagcaaataaaaagtatcaccagttgtcacagccaactaaaaacaagagatgtgagacggttttggagtgcatccagacttatgtgggaacggatgaagccgatattttcattgtggacttcgtgaaatatgtctcgaaacaccgaaggttcaaatttcgaactagatttacgactgaagagacgttttgtgctgtaattaaattcagactgtcggacggatttttgaaatctttcaaaagtttctctcaaaaaacgctcggattcgacatctttggctctcgaaaggaagttgacgagcacagaaagaaattgcaagtgcatcaagaatatgagatttcgatcgaaagttcaactacaaaaactcgcattggacgtgagattcccattcaaaatattatcgcggtctgcaaaaatgttcctgaagttacgagaagaagattagaaactttgtctgccaatgacaacctggttttcgatgaagggataggggatgatattatcatctccgcagataccggtgatggagtaacaaaagtttgtatgtctatcgagaattgtcagaagccaaacagcagtctcaccgagacggctcttggatggtacactggtacagacaattacacaaatctgaaaaagtatttcgcggggattttcgagcagctcgaaaaaatgacaagcattcgttatcaagaaaaaaatgcactcgttattcgaaatattcgtctgaaattggtaggagatctgaaatttgagtcatctgcaatgaatcatccaggacaggcagcttcagattcttgcattttttgtaccggcagatgggctcattctggtatgaataaggctacagttcaatccttcgaatttga