Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T08B2.9   

sjj_T08B2.9 RNAi JA:T08B2.9
Simmer:T08B2.9:Screen_A
Simmer:T08B2.9:Screen_B
PCR_productsjj_T08B2.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST08B2.9a Source_evidenceePCR910WS150 Sequence/Annotation Release
Overlaps_Gene T08B2.9 Source_evidenceePCR910WS150 Sequence/Annotation Release
Chunk_score Abs_score768
Max_abs_score768T08B2.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI62131526214351
Overlaps_transcript (5)
WB_DNA_textsjj_T08B2.91200tcttcagggaacttcgtgctaatcgcgggatcttgaaaaattgaaaaatgaacaagatgcaaaaacgatatgaagaatctaaccagaaacgaagaaagtatcatgagcatctcttgcaggatgctgttgaggttggaaaagggcatcaaagttccagaaagacgactccacgtatcgatttgtcgccatttcagaaaatcccattgagaagaagatttgtcggaattcagaccgcactttcattaatggatgcagatgcccagatgacggaacaactccgagtgaatcgaaattatactttttgaattgcatgtctttccatgaaccactaaattatgagttttcctatagaaaagtaattgtaagtaacttacgaagcaatcatttccggagtcaaatcagcttcctgctttgcaagactagtggtgaaagatgttcccttggaaaccaccaatgctttgatgtttctaaaatttgatttctgttaaatattagaaactattgacaaaatgcatacacttcactgataagctttctcttcttcagctccttcttctcattttcactaacatcggaacttccaattcttaacgactcgagctgttttctggtggaatcagttacttcagtggcttgtcggacgacacgtcccttatccacagaaacccatttgaactgcatagctttcgccataccaatttttccaaatggtttcttctgaaaaaattgaattagaaacttcgcttgatgatgtttttttaacctgaatgtcagcttgcgcggctccatcagttccaacaaactcaaaaacgaggtactccggcgaaccttcgttagcaaactgtactccctcgttagttaattccagccgtttctcggtcacatctttggtggtaagaaccccttcgtttgcaagcaaacttttgattgctccaatcactttctgatgatcgagattccattgctgggcgagttgaattgagttgaattcattcgattcttgaaggaaatcgaggatttgttggggtaggttctccgttgatcggacatcagtttcagcagtcattctaaaaaaaataattatgtaaacttgagtaaaatgtgaagttaaaactaagaaacagtaagaaatcaatgaaagaagctagatatggatatcttactcaaaagatgataaatgctgaaaccagcgttccaaat