Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T08G11.5   

sjj_T08G11.5RNAiJA:T08G11.5
PCR_productsjj_T08G11.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST08G11.5 Source_evidenceePCR885WS150 Sequence/Annotation Release
Overlaps_Gene T08G11.5 Source_evidenceePCR1009WS150 Sequence/Annotation Release
Chunk_score Abs_score904
Max_abs_score904T08G11.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI88975878899255
Overlaps_transcriptT08G11.5 Source_evidenceePCR1009WS150 Sequence/Annotation Release
WB_DNA_textsjj_T08G11.51669gcctttcccaggtgttgttaatttttcttttttattaaaaaaaacatacacttgataaaaacaaactaaaccagtttgttatttgattcacccgcaatttaaaaaatgtaaacagtttgaaagacctatttgaagaaagaaaccaacaatttactataattcagggaatattggatgctgtatcgtatttctctttgagacgatccaacatttcttgttgatcaattcctgaaacaatacatagttgtagtttggttgagaaatatattagaactcactctggaatacgtgaggcgcggaaaacagaataccacatgttcctccaacagttattccaaaaaatacataaagcagcaatcgatcgattatcattgccacatatttccaatcgtctcggaactgaaaacggaacgttagagttggtatttcgaccccaataaagttgtttcaaagttttttgttgaatgtactaaatttattatttctcggaaattcaatacaactttgtcgggcaccaaattatagtggtttctcgattttctaaacgaatgttgcacgaatttatttgggtcggtctcaccgccaaaaagtggtgtccctttttgttttcgaggtgaacgctttcccattcaactccttttctttcaaaattaattcttaaaacactgatatcttttttataaaaagccaagttaattctatcaataaatgcataaatttgttaatctccttgtgtctttaagttcaattttcataaaagtgcaaaaacacatcaaaaatttatatcctttttaggagaaatgttcacaaaaaaactaaccgatttatgttgctcgtctcttttcaaatgttccgtaatatactcaattgcatcaattgctcgtagagcatcagtacttaatggataatatgcagacgtctcatttgatgcagtatttcgaattgtagttgttcgatcatcagctgatggacatagtggatgatgagctgatgggcttaatgtaaactgtccaactcctggtagttgggccattccagaacggacagcgcttcgctcagatgccgattttgggcgtttcatgcaaacaagttttggaagaaactaaaaattcaaataaatttattataagtttgaaacagaaattggaggcaaacctgcaaaaatacgactcgaacccattgtggcatccgatgagttcttggtcctcggaaatatacattgataatgatgacagtaactagaattgtgataacattaagaacaaatgtcaacagtagatatttggccatcaatggaattgtagaagatgttggtggaagaatctttgatacaagaagcaagaacacaacgatggagagtagaacagatattgtcaacgttattttttctcctgaatattataattaaaataagaaaacaatttgtgttttaaaaaactaagttagattcagaagaaatataactatattttaaaattaaaattcactcaccagaatcagtaggcaagaaaaatacagccatactcaagaatgccattaaaaccgttggaataattaggacaacagtgtaaaaaagtgtctttcgacgaattcgaacttgaaattcaattctcgatctcttattgaccaatgatgctggaacatctataacatcccaaattgagcttgc