Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T09A5.11   

sjj_T09A5.11 RNAi JA:T09A5.11
Simmer:T09A5.11
PCR_productsjj_T09A5.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T09A5.11 Source_evidenceePCR1097WS150 Sequence/Annotation Release
Chunk_score Abs_score1034
Max_abs_score1034T09A5.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII78647777865968
Overlaps_transcript T09A5.11.1 Source_evidenceePCR1097WS150 Sequence/Annotation Release
T09A5.11.3 Source_evidenceePCR1059WS150 Sequence/Annotation Release
T09A5.11.2 Source_evidenceePCR1097WS150 Sequence/Annotation Release
WB_DNA_textsjj_T09A5.111192aagtttgtggatgctggagggaatgttctggtcgctgctgggtctaacattggtgatgctcttcgtgaaattgctgctgaacatggattcgaattcgaagaagctggaacttctgttattgaccatcacaactacgatcaaactctcgattctggggatcacacaactctcgtagtcggaaaagatcagctcattagtgcggaactgatcgttggaaactcggcaaagctgcacccagttcttttcaagggaattggattagttgctggaaagacaaataatcttgcactgagcattgtcagagcatctggaaccgcttactcatatgatccgaaagctgttcgagctacggtaatatttttatttatcaaatactcgtccaatatatatttttcagaatccatctatcgccggatctcgtacattgctggtcggtggacttcaatctcgaaacaatgccagaattgttttcactggaagttccgaacttttctccaataccttcttctccgcaaaaaccaactccgtcaatccttccgtacaaggagctcaatctggaaacgccgattttgctacagccatcactagatgggtgatgaaggagagtggagttcttcgtgtcaagactgtcaatcaccacaagaaaggtgaaactgtaccaccagttgagggttatttcattaccgaagatgttgtttacaccattgaaatcgaagagttgaagaatggaaaatgggttccattccaaggaaaggacgttcaacttgagtttgttcgcatcgatccattcgtcagagcaacattgaagaacagcaatggtcgtcttagcgttgctttcaagcttccagatgtgctcggagttttcaaattcctggttgattacagacgcgttggatacactcatctctatgatgtgcaacaggttagtagaacgatgtacaatctttatttgcattacacatattattcaggtgtcggttcgtccattgtggcacacccagtatgaacgtttcattcgctccgcatatccatactacgcctcttcgttctcaatgatggcgggactcgtgttgttctccatcgtctatctttatcataaagatacgccagtcaaaggagccaaggttctggattccgaaaagaagaaaaactaaatgctcttttttcgcaaagtttgcctcttcgcctactg