Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T09A5.6   

sjj_T09A5.6 RNAi (2)
PCR_productsjj_T09A5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09A5.6 Source_evidenceePCR475WS150 Sequence/Annotation Release
Overlaps_Gene T09A5.6 Source_evidenceePCR475WS150 Sequence/Annotation Release
Chunk_score Abs_score374
Max_abs_score374T09A5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII78537317854886
Overlaps_transcriptT09A5.6 Source_evidenceePCR475WS150 Sequence/Annotation Release
WB_DNA_textsjj_T09A5.61156atcggacaagaaaacaaaaacaagtaattatcggtttaaacctgccggaaaaattttttaaaaaagcaaattgttcaagaaaaatatatattcaattgataaataatacccgagatttaaaaaatataaaaaatgagcatgttatgataaatcgagatcttctctgatgcttctgtagtacataacgagatcaggcatttcttcactgaattctttcatcaaatgggcacggaatttcttgtaaatctcaatcttgccattcacctgaaatatttaaatatttaggaaaaaattatgaaaaaagaaacaaaccgctttattcttttccaaggttttctccatacaatgtttcgaatacagacatggattttttccatcatcaagatatggtaaaagatccaatggaaccttcttatcactaaaagttcctttcattctatctagatcctataaaatttgaaaattaatttttaggactattgctcaaataaattcacctgcaaacctctaactagtgtgtatatccggccatttagagcgtcttgatactttgtttgaaaattggaagcaagatctccgatgaatctcgcattttcttggaattcttccaatttcttttccaattgcagtattttgtcatcttcttgttttctcctctcctcttcacgctctttttcagtttttcttgccaacttctgaaccatgtactttttagtttttttgtcaagcgaagaattttgttaatctaactggaaaactcaaaaacgtttaatttcgatattttttaaaaattgtactcgatattttaactatgatcaaatttttaaaatttttcaacaaaatgtttcaaacttcaacgtgtttttggagaaaaaaaatttggattcagctctgatcctcggtttttcggttttactcaaaaatcaaaaaaaaatccaaaaattgaaaaagttttttggttcctttgctcaaaaaaactcaaaatatttatttttgtatgaaatagggtgagaaccgtaacaaaaacatcgaattccgttaaaaataccaactttgaatcgttttcgaattttttgttttttggtttttcaagaaaaactttctttttaatttttctgtgatacccttcattctcacctctctatcgtttctttcg