Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T09B4.4   

sjj_T09B4.4RNAiJA:T09B4.4
PCR_productsjj_T09B4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09B4.4 Source_evidenceePCR429WS150 Sequence/Annotation Release
Overlaps_Gene T09B4.4 Source_evidenceePCR531WS150 Sequence/Annotation Release
Chunk_score Abs_score447
Max_abs_score447T09B4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI61679516169391
Overlaps_transcriptT09B4.4 Source_evidenceePCR531WS150 Sequence/Annotation Release
WB_DNA_textsjj_T09B4.41441atttcaattcacattttgctgctcgggtttggctattttatatattaacattttaaaacaaagaagaaatgactgaatttttctcgcagaagcagattgatggtaagtgaaacaacactataattccaagatttgactccgaaatctttactttattgtttctcatcagaaattcgtgaatgcttcaacttttattcaaccagtggagtactaagaacagattctcaacttcgatgtgctctccgaagtcttggatattctccaactgcttccaaaactgatatttatttcaagaagcttaatagtatgagttttagaacattacacttctgaatgattgctatttatttcagaaaaaccaatcgaatttgcaacatttttggacatttgcaaagatgaacaaaatagtccgaatccactgacggagattatcaaagcgttaagtggattggataggttagttgatgtgctttacaaaataaatacgaaattttcagaaataaaactcgcgcaatgccatctcgtgagcttgccgcaatactttcacacgttggggagcaaatgagtccagaggagattaaatatcttttatcaaaagttgaggtcaacggaatggttcctcatcaagcacttattgagtatatttccaaatgaaatttactttgagcaaataaaaataaattgtttttatctgggagctgtctagtgagttattggattaagaacggctgcaatatatttggaaataattattaaaaaattataattttcgtcagggcagtcacaaacatgtcagaacaaaacacgaaaagtaaaattaaaaataaaatcctaatctttttctcgcgactaaaatgtctgaatcagtattttagtaaagaaaataccccaaaatagttttggataatttggtaatgaccaaaatagcagataaaacaaaaatgaatacagatggattgaaaatttgacttttggaatcaccaaaatcaccaatcgccaaaaatgcgaagtgcacaattccaatgatgcataaatatgtatagagctcgtcccggtttaatttcaattcttggaatgttaagtttacgtaaagtcatgttaaagctttcgaagtgtatcaaactttcagtaaaaagcttgaaatacccagctttccgaggccgtctctgatctggcaagttgagcaacgttgattccagtttgtacttggattggaggcggcctgagaatcctgaatgttacaagctttttgccaaaaagatgtagatatagttcgaaatcttgaacatgacttcaggtaaatctaacatttccagaaatgaattcaaatcagtttttgtctcctccataggagatgttccaaaatttgtagccgacaccaaatttcttttcgtcagaattgttttgcgtaccattatcacctcctcgaaataaacagatg