Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T09E11.1   

sjj_T09E11.1RNAiJA:T09E11.1
PCR_productsjj_T09E11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09E11.1 Source_evidenceePCR857WS150 Sequence/Annotation Release
Overlaps_Gene T09E11.1 Source_evidenceePCR857WS150 Sequence/Annotation Release
Chunk_score Abs_score794
Max_abs_score794T09E11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1233787312339054
Overlaps_transcriptT09E11.1 Source_evidenceePCR857WS150 Sequence/Annotation Release
WB_DNA_textsjj_T09E11.11182gtgttgattttgtggaccccctccccccgcactctatataaaccatgttctcctgcttctgaaattagcagcctaaattcaagatgaaaaaatatcaaacccttggaattcgcgttttctttctggctatgtttctgtttattgtatcaaaaattgtggcggaattgtgagttttttgttggccagcgattggattttgagtgatgagttttcagggagcaagttggaggatttgaggtggaagatcgaacgattattgtaattacaccaacttaccggaggatcaatcgaatgcctgatattacacggtactcaggaacaaaagaacgatcataattataactttaaagtatattttggcagtcgatattttttgacagaatttttagcttctgagtaagatcactgtagctttcagactctccaatactctctcccacgtgaaaaacctgcattggattgtaatagaagacggcgtgtcgactgtgccagcggtccgagcggtcttggagcggaccggcttgtcctatacctacatggcacataaaactgctcagggatacccggcaaaaggatggtatcagagaacgatggctctgaagttcattagagagaatacgtcgcggattttgaacactgatctcagggaaggagtggtatattttgcggatgatgataactcgtatgatttgagattgttcaatgattttattagaaatgttcgaaagctcggggtttgggctgtgggtaagcaagctgctagtcaaaacacagaccattcattttttgtgtatttaggatttgcgggtggcgctgcagtagaagctccaaaagttgtggacaagaaggtgacgtcattcgacgctctttgggtctccaaacgattattcgcggtggatatggctggatttgcagttaatctgaagtggatcctaagaaccaatgcagtatttgggaaaacatgcaatcgaggagatggggctccagagacatgtctattagaagatcttggatttgatttagaagatatcgaaccatttggttatgaaaagcaggtcagtaatttcaaagtgttgctcctggagcacctgacaaaaacgtgagactggagcgcattctagaaatctagtcgtgtcttggccaagctccaggagcagcaatttgctctttctgtccgtgatg