Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T09E11.6   

sjj_T09E11.6RNAiJA:T09E11.6
PCR_productsjj_T09E11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09E11.6 Source_evidenceePCR902WS150 Sequence/Annotation Release
Overlaps_Gene T09E11.6 Source_evidenceePCR902WS150 Sequence/Annotation Release
Chunk_score Abs_score776
Max_abs_score776T09E11.6
Specificity_index0.859
Rel_score1
Map_statusUnique_ePCRI1236473012365890
E03H4.3 Chunk_score Abs_score127
Specificity_index0.141
Rel_score0.164
Overlaps_transcriptT09E11.6 Source_evidenceePCR902WS150 Sequence/Annotation Release
WB_DNA_textsjj_T09E11.61161gatcaggctgccctactcacgttggcgacgatcgcggtgttgaactttcaattttccacgtataacctaaaatttctgtaagaaaaatgcatttttgcaattgtttttttgcaaaagttttaaagtttcaaaaatttcagaattccagcagagctctacacacattttccggcaatcattcatcaggaaatttttccagcgtaagtccttgagctagctaacagcactgcacatcaaacacaattttagaattttaggaccaggatcattgccaagttgattccagggattgagcattcagcttctgctcttaggctaccaaatactggtcaactattctgctttgttgagacttcagaacggtacatggatgaacgcgtaccatcaattgcatccacgtggctacggagatgtgacaacgggcggttcttctcaaaaactccgcttctaaacctcaacataacttattctacagtttataaaaatctggaagactcatattccgatttgttccgaaaatccatattcggattctattactcttatgtgcacatttcaaagtctttcgattggtacttaaaggcagatgatgatacatattttgcaatggatcacttgagggagtacctgaacactttagacccttcgaagccattatatctaggatacgtgctgtaaccctatcttgtaagttgttatgtccatcatgtccgaatatcgttttacaataagcgtaaacatattgctttcagaaaaacggttacaactccggaggatccgggtatatcctttccaatgcagcagtgaagctttttgtggagaagtcgtatcatgatgaatacgggtgtccgtatgattgggcagaagatcatggaattggaaggtgccttgcaagagtgggaatctacccaactgataccagagatgacaaaggactcaatagctttgtgccgttcaagccgagtgagctggctgaatttggtccggactggcacttttatccggtaaaggtcagtcgtgtggtactgttcttattagaaattgaattgaaattttacaggccgtccaatttgcgtctcaaaagttcgtttctctacatcgacttcctccggccatgatgcttgtgctggacgagattctacacccaaaactgggaagaaa