Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T09F3.1_b   

sjj_T09F3.1_bSequenceCCCGAATATAGCAATGAAAACAG
Length23
In_sequenceSUPERLINK_CB_II
PCR_productsjj_T09F3.1