Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10B11.1   

sjj_T10B11.1RNAiJA:T10B11.1
PCR_productsjj_T10B11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10B11.1 Source_evidenceePCR525WS150 Sequence/Annotation Release
Overlaps_Gene T10B11.1 Source_evidenceePCR577WS150 Sequence/Annotation Release
Chunk_score Abs_score514
Max_abs_score514T10B11.1
Specificity_index0.833
Rel_score1
Map_statusBest_ePCRI69511456952029
T10B11.8 Source_evidenceePCR124WS150 Sequence/Annotation Release
Chunk_score Abs_score103
Specificity_index0.167
Rel_score0.2
Map_statusBottom50_percentile_ePCRI69511456952029
Overlaps_transcript T10B11.8 Source_evidenceePCR124WS150 Sequence/Annotation Release
T10B11.1 Source_evidenceePCR577WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10B11.1885tatcagttgcccttgatctgttttctatttacaaatactttttacagactattacccattactgttccttttcttctcaacgcatcttctcattcaatgcattcttcatattctcattttcttcaacgtcttcgtacatccgtctcatatctctctgtctctcattttccatccacttcatctcatcggttattctcgaccacaatcggtgtgtttgccagaaagaaaatggtgagttttctcatgttgttattatacattttgggagaataaaaaaatgtgtgcattcagtttcatttagtttattttttaagtgctcatatatatttttcttgaagaatgttagaattagtaaatcatactaccctgtgaaagaaactcaggaaataaaattcccgatttttagcctcttctcaccgaatctgaacgtactgaacaactttcgggcctgaaaactgctggatggaaacttgtcgaagggcgtgatgcgattcaaaaggagttccatttcaaggattttaatgaggtatttaaatatcccgaatagttttctttatcttaaattcatttttctaggcatttggtttcatgactcgcgtcggattgaaagcggaaaaaatggatcatcatccagaatggttcaacgtttacaataaggtggatatcactttatcaacccacgattgtggaggattgtcgccaaatgatgtgaagctggctactttcatcgaatcgattgttaaaaagtagattacatttttcgttgtttatttactttgcaaaaataaaatatataaattgtaacaaatacgaagttgaacataaaaaacaaattttaaaacgaaatgttttgaaaattaataacaacacacactcacgaaatca