Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10B11.6   

sjj_T10B11.6RNAiJA:T10B11.6
PCR_productsjj_T10B11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10B11.6 Source_evidenceePCR953WS150 Sequence/Annotation Release
Overlaps_Gene T10B11.6 Source_evidenceePCR953WS150 Sequence/Annotation Release
Chunk_score Abs_score806
Max_abs_score806T10B11.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69434046945565
Overlaps_transcriptT10B11.6 Source_evidenceePCR953WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10B11.62162ctaacaaagttcaggcaagctgtacggtaatcttttggatgtgttcgaatgtgtgcaacatgctcagagtcgacgaaatcaatagcggtcactgaatttcctttttctttttgtttttcaatgaatttctcgacatgtctgaaaaatctcataaattgatcaatcaacgtaataaattgtacatacttcgccttgatcatagtgtcagctttagagtataaatacagttgatcacgtggcagggcaatatgtgtttgaagataatagtagattgacacaaacgaacgtaaaaatggaaccatcgtaagaagtgggatttgctgaaaaacgaatttgaatgaggtttttgaaaattcaaatatggggtttttcttcgtatttaatgaaagaggtttactgatttttgctaagagattgtctaaaactggattgaaagaaccgaattttattaagaaaaaatttccaaacatttttatagacgggtcaaaatttcgaaaaaaaggtaaccttacaattagttacaatctgaaatttcgccaatttttccttgccgtagcaactggaatacagtttttattaaattatcattctttttgcatattttggtagtttatctcgcgttagttcgttgatttagaaacatttaaattcgaattcaattttggtaattgttgggtgcttatcgacttgaaatgttcttaaatcaatgaagtaaagcgagataaacgaccaaaatacttaattcaaaaattttaaaaaataataatactgtattctagctgaattttcagattttagcaaaattttattatttttttcaaaaaacctgcaattaaatttttttgacatttttgaggtctcgaatttcggtcttttcagaccagttttagtatatttgagcaataaaaatagtcacaacttccaaaaaataagtttaaatagtgttttctcaattatgaaaaacgaaccaagtaagctcgtagattcaagaaccaagtaagcacagaaattctcgtttgctcactaatccatcgttcaaatgcatcaattggaggagttgaaatgaccattgccgtagcgtcttgttttccatatgggcgcgatggggcactgaaaaataaaaatttaagaataactgaaaccaaagttcaatttcaatataaaactcacctatcgaaaataattcctttaattcgttctcttaattgtggtttttcctctgcttctgtccatttccaaaatgaaattaatccgcgtactccgttcattgaaaatgagtgaacaattattggactgaaaactgattaattcaatatttaattttttaaaaatcaacccaaccatttggcaaatgatctgaaatctccgggttttgcatcaattgctctgaaaagtggtgacatgtagaatccaacacgagaatttggaatactatagtgataacatggtggacagagggagacaactcgatatctgaaaaaatgtctaaaattatatatatttctcattaaagaaaggcttataaaataaactcttttaaatttcaaaattctgggtaaaagagtaagttttttacccatttttttcaaataaaaaactaaaatttacccttcatcattataaactttaatatacttgtcgatatgctttggatttgctccagcccatccaaccatcagaataactggttttttctcatcatgatgactgtccgaaagtacaatcgaatcgacggtaacatctgaaaattgaataaatattttcaaaaaaacgtattcttatttttccattttctgtacaaaccttgagatttggataaatgaatcatcattttaggttcaggaacatgtcttgtaaagtaatttctcttttgaatacacgttgagataactgctgaagatgttgatgacgtggatttggcaatttttggaagaaggcgccgggatgcaaacatctgaaaaatattaatttgatggaaatttaatgtgaataaaatagtgtatttagcaggagcttatttaagatttcaatctatttctggaatttactctttatcctaaaaccattccagaattcacaagcgttccagtttttgcgttcataaaaatagtcagtttgtcgaaaatccccaaattaaatagaatgttttcgacttttcacga