Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10B11.8   

sjj_T10B11.8RNAiJA:T10B11.8
PCR_productsjj_T10B11.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10B11.8 Source_evidenceePCR915WS150 Sequence/Annotation Release
Overlaps_Gene T10B11.8 Source_evidenceePCR915WS150 Sequence/Annotation Release
Chunk_score Abs_score789
Max_abs_score789T10B11.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69523406953511
Overlaps_transcriptT10B11.8 Source_evidenceePCR915WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10B11.81172cttctttgccaaatccaagcgatatcgaaacatcagaaaaatgtgatttacgatccgatttggtagagctaaaacaatttattccgaaatcaaaatataaatttaaaactaactcattctttttctcaacatttttcagattgaaatcgtacttttctttgtttttctcatgtggccaggtatcttgtttgattatatttttatgagattgtaaggggtacagacgacgaacgttgactggaattggatgatgatcataagatgctgaaattaaattttcagaattagttgtcagtttttctatgtatacttgtctgctcatttcccattcgatagttatcgaaactgttcgtatagtgattataacgattctccagatcacgctgtttcggttgtgatgaatgtggatcagaagggctaaaattaattttgttaaaacagctctctctctctctcgcaaagctaacaaccaaccgatcatgtgaatttttcttgtcattattccttttaatttcatactcaaaaacggtctgaccagaagaagatgaagaatctgaagaatggctgtttgattgatatccacttgaagttgaggcagattttgatccagaagatgtcgacttctttttctttttcatattgagcttttcttctctagcgcgtgtaaaatctcccgtcgaagtactgaaaaaatgaaaaatttacataaaaataaatttaaaaaaacttacgattttggttttggaggctcctcgactgcgatttgagatgattcaaatgtaagatggaacagcggattttcaagtttttcctctgacatcactttctttggaaatcttctttaaaaaaaagtttttagaaattcggaacacgacaaaaagtggaaaaacgaaaaactaacatattcccgtttttattgagtttcggtttttcataatccttcctccacgaaccagcaggccaaaatggattaatatttttgtcggtaatctcattgagcttccgacacaaagaaatccgttgctctttattataagcttctggttctccgggtaaagattttctgtgggcgataatgagtccgtgtttatttagatgaatatcgtaatgatcacggagctgtggaatggtcacatacatttggatagccaaacgaatttttgcgacctttg