Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10B5.6   

sjj_T10B5.6 RNAi JA:T10B5.6
Simmer:T10B5.6
PF:GL1_4F2
PCR_productsjj_T10B5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10B5.6 Source_evidenceePCR855WS150 Sequence/Annotation Release
Overlaps_Gene T10B5.6 Source_evidenceePCR855WS150 Sequence/Annotation Release
Chunk_score Abs_score792
Max_abs_score792T10B5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV18691061870076
Overlaps_transcriptT10B5.6 Source_evidenceePCR855WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10B5.6971gctcatcatcagcagttccaaagaagaaagtggctcgagaggtgccacgtgcagggccgccagtttttgccctcgagcacgatgtttcggaagtcaccgacagaaataaagacggcacctttctggctgcagacgcgtgcgctagtggccctactttgaaggttccagacgaaacacaaggttgcccagaaactttcagtgtttcggaacacgaagatgacgacgacgttgagccgatggaagttgatggaaccatcgttccgtcgccccagcgagcaacgccgacacgtggcgtaactccttgcgaaaaatcgacgactccacgcagaagatcctcgagaaagtcgatgccaacgcctgggaagcgtctgttcttcaccagcaaagacactacgaacgaggatcgcaaggctgatgactcgacgcaactggagcttctgatggcaaagattccgcaggagatgtcgggttacatgaaaaagttggccaccgacatcaaagaggtagtattatcgatttttaactttacatttaaatctaaaattttcattttcagatgagccaatacgatgcacagctggcgcggaatatcgacgacatggaagcggttttcaaatcccgcgaaactaagctcaagtcagctattgaaatcgccaaggacagcttcatctcgtccgctctgcctcttcgcctcgagaccctggacatgactctgcgtaaagaagaatcgccaaatgatatcgttgcgagacttcacggaagttttctcgacaaaacccaggatgccggaaacgtgaatactgcacaaaaggagaaccagcagctggaggatgagcgcgggatgctggtgagagtttcaaattatttaaatatgatttttaaaaataaaaatacaatattatatttccaggaagaaaagctggagagtctcaacaagatcaagagagagaaggatgaatttctggcgaaaa