Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10E9.3   

sjj_T10E9.3RNAiJA:T10E9.3
PCR_productsjj_T10E9.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10E9.3 Source_evidenceePCR933WS150 Sequence/Annotation Release
Overlaps_Gene T10E9.3 Source_evidenceePCR933WS150 Sequence/Annotation Release
Chunk_score Abs_score870
Max_abs_score870T10E9.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI65373206538374
Overlaps_transcriptT10E9.3 Source_evidenceePCR933WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10E9.31055atgcaaagaaaggacgttggtggacagcaattggagttggagaatcaatgaatgatctcaatatgattctattatttgctgaaaatggtcgtttaaaaaaacaaggaattttcaaaactgaaggaaaaatgcaaccattggaagttgaatatgaaggaattgaagtgaaaaaagatttggctattgtgaataatgggaaagcgaatttcgatgtttctgtcgagaagaagttcttcctggatcgagccgtgagtttttttttcagtactcacaaaaatcctgcctattagcaaaacttaaaattttcctgacaaatttttaggatgaacaaggctgcttcactatgcaagttgcaattctcgctggtcaatatcaagcaaacaatttcaatgttcaaaaacatcaaaatactccagaacgtattcaaatctgtaatgtagactcatgtcatgacccaattgagccccaacaggaaattgatggagaaactccgaagaaaactacccagcctttagtcaaaggcgatgaggacattattgaagcgtctggagtaactgtgccaacaaaagaagctctaattaatgatgtggaaggttctggacttcctgtaacaccgaaaattgagaatgaagaaccaaagtctacaccacatacagcagaagttgcagatgagcatccattgactggagttgatgctccaagttctgttacgtcatcatcatcttcatcatcttctttgtcaactgctggccctcaattagtgtcttcttcaaccccaattcctgtaccaatgacccctgaaaaaagtccgtttttcctaagattaacccaaaattcattggaatttattccagatcatgtcttcgaagtcgataatcaaacaaccaaaacagtgagtgaagaaccgaaaaaagaagaaacagaaaagatcaatgatgcaccagaagttacaacaccaagagctggaagtcatggagatggaagtaaaaatggttgtggagcagaacatgaagacttgaaaatttgtgaatcctactttgccgagtatttgggaa