Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10E9.6   

sjj_T10E9.6 RNAi (8)
PCR_productsjj_T10E9.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10E9.6 Source_evidenceePCR429WS150 Sequence/Annotation Release
Overlaps_Gene T10E9.6 Source_evidenceePCR429WS150 Sequence/Annotation Release
Chunk_score Abs_score387
Max_abs_score387T10E9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI65289596530072
Overlaps_transcriptT10E9.6 Source_evidenceePCR429WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10E9.61114gtgtctggaatggtatggattgttaaagttaaagctattcacattcataaaaactgttctattttcagccacaaaaattaaattatcccagtaataattttcgccctgagcttggcagctgaagccatttcaaaatatgggctatcaaatgtcataggtctccatgtacaagtcatgacgtattttaaacaaaaggaaaagtggaaaaatcttctcataatataacataatatcataaaatatcaatcactcattaatttctattgaatattgaagactttcttatgaatcaattcgatagttgggttagatggtggcaagaaaagtccaatgaatacggcaagtttgatgatataatacaatggaatatactccaagattcgatcgaaaagataaaaaaatccgaaaattgtccaataaatgaacattattcctgtttcaggtctatccgatggtcccaagtatgtcaaaataatgggagcaattacgagtagtccgtttgccaagtagtgaggctctttgagcacaagcaacaatccaagaagaaagagaattgttcctttgatcaactgaaattcagattttatctttttttttaagttgacaaaaaaactactgtgcgcaatggtgtaagccttgccggtaaatgtcacacatgtcacacacacaatgtcacaaatcacacatgttgaagcaggaatacggtagccggtctcgacacgatcgagaaaggcgccaaacgatgtgcgcctttgagatacagtactcataactgtttcgagagttgttattgatttttctctttctgagacccttttactttgtaaacttcaattaactgaatcaaataaattgaaaattcacagacaggaaacaaatcgaatataacattgagtatacagtactctttaaaggcgcactgttttttattcgtgtcgagaccgagtactgtatttttgtattcgccggataattaccgattcaacttcgattccagtgacttcactatatcttttggcccatctcgccgtgaaatatttctcattgtgaatgagattgatgaaccaaacttgaacttccagctctgacttgctcatattggaatgattttcca