Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10F2.3   

sjj_T10F2.3 RNAi JA:T10F2.3
Simmer:T10F2.3
PCR_productsjj_T10F2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10F2.3 Source_evidenceePCR1246WS150 Sequence/Annotation Release
Overlaps_Gene T10F2.3 Source_evidenceePCR1246WS150 Sequence/Annotation Release
Chunk_score Abs_score1141
Max_abs_score1141T10F2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII51670605168758
Overlaps_transcriptT10F2.3 Source_evidenceePCR1246WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10F2.31699ccaatgcaatccactcaatgttgcaagatcttttttacagatctgaatgctgaatgcatccacaaattgttcatttggattccctccgctccatgctctttctacaagagcatcagcagcatcaggtaaagccataaaatcatcaactttcttcttctccaccttcggacgaatagcgattccttgcaattcaagtctcttccgaacatcttccaatcgatcacctcttgtttgagagcgatgtccttctcgtatccgagcctcttctagaagtttatcctccttctgcttcgacaattgataagaattctgatatctctgcggtcctcgatatgcggaaccgattccaaggctattaatttgcgagagaatatcattgagtttcctgtatgaatcagattccgacgaatttgatcgggcgtgttggcggtaacttaaatttatattattgcttgaattgatgaaaaacttaaataaataccttgaagaagtggactcttcgctatcaatgatgatggatggttctcttgataagagtgaaggggtgttgcttcgggatcctcccaattctgcgattttctgaagaaaaaagatcagaaagttttaaataacagtaatatcctgaacatacattcttcgctctggctaatatgtcagttgatgatgttctctgcattttcttcggttttttttcaacaattccagaaatcgctttagcttcgtattgtccacttgcaacaactccttgaagaagtcgatcgcgagatgacaggtgattttttatctgaaataattaaaccttaaaaataaataattatctataaaaacagtggaccgaaattaattctaaataacaaaatcgtctaatgtatccgttccaaaatcaattttaatgttaaaaaattgaatcttgtaggttttgcggaccatttgggaagaaaaatcttccaaaatggtttttaaaaaaacctataaagtttaataataagaagtttttggcatttagaattaatttctgaagcttcagtttgatacactgaaaattgtaatttctcacattagtttctctgcttcataaagaaataattaccttctttaaatcaataatcgtgttcattttccgaacagaagttgagtgcttaaattgatgtctaacagggacccgtctcaaaacctctggctttttagcagaattccgtctccaataatcacgaacattatttgatgtgtaatttgataatgatgataagctcggagtaatcggacgactaacactgtcatcgggtgtcggtgagataaattctttgctcctagagtcagaaataactgatacatcgtctggtgtgtctggattgtcgttgagaaagatcaactaaagtttgataatttattataatagaattattcgaatactaatacctcattctgaaatcgtcttgcttcttgcaattgcttatttggtgtcttgactactttctcgaaaagaacgtctggttcctcatcatcctgttgtacttcaaatgacttttccaaattttttggcgactttggggaagatgataaggtgagcactaaatctccttgaacttcttgtttttcttcgtcattccgaatttcaacgtttttttgaacatgtttctcaatgataacttcattttcctctgatccagcattggctctcacaggtgcatcttcgttc