Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10F2.4   

sjj_T10F2.4 RNAi JA:T10F2.4
Simmer:T10F2.4
PCR_productsjj_T10F2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T10F2.4 Source_evidenceePCR1087WS150 Sequence/Annotation Release
Chunk_score Abs_score1024
Max_abs_score1024T10F2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII51703485171546
Overlaps_transcript T10F2.4.1 Source_evidenceePCR1087WS150 Sequence/Annotation Release
T10F2.4.2 Source_evidenceePCR1087WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10F2.41199aacacgtcaccaatgaacgagcattttctccgaatctaactccagtgactggtccagaatgatcagaaagtgatacaacttcactccagctcttcacatgcaaaacttgaactttttggccaccaattcctaggaatgttccagtcatgtcgaaggacagggagttgatctgaaaaaattatattttttcattaaacatttgcttaacaatttcttaccggttgtttctcttcgttagcgaaagttttcagattcttcaattttctaagatcccataatttgacctctccatcctctgatcccgtagccaaataatatccgttttcagaaaacgcaatcgaacgaacggcagcagtatgtcccgggaatgcagcagccacggtttgattcttcaaatcccaaatcttcacaacggcatccgcagctccagttccaaaaataagaccatcaggatggaactcgatggaatgaacggcaatttgtgatcctggttcaactgaaaccttgcaaagcgattttccggaacgaatgtcggagaatgcccagtaagaatcatcagaagcggagagaatgtaatcaccggatgcattgagggagatatctgtaaaacattgtttgttcaatagaagaattacagctagcgaatttttttcaaatatctcacctgtaacgggtgcctgatggacatcaataatagccttcgaagacgaatcagttgcactccagactctaatatgtgaatcagcagaagcagagattgcagtaatattatccggatgcaaaacaactgcgttgatcttcttgttatgccccttgaatgtttgcataacctgttccttttcatagtcatacaagacaacggttttatcaattcctccggtaagtgacaaatttcccttgatatccaatgcagtaattccaggagttccagtcgaatgaattccagtgtgagatgctgtctgtttcagctcggcgagctcttctgttttggcaagtccttcaggaagattttttcctcgttgtttacgttcagcagtcagactctttgatttctcttcaagttttgccagaattgcctcactaagaccttgttgatcttcagactcgtcaatgctgacatcatcgtcaactttcgccgatgtgtgtggtttcaaagtagacaatgcttctctagcagcggtcaattctttggagaggcg