Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10G3.6   

sjj_T10G3.6 RNAi JA:T10G3.6
Simmer:T10G3.6:Repeat_a
Simmer:T10G3.6:Screen
PCR_productsjj_T10G3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10G3.6 Source_evidenceePCR294WS150 Sequence/Annotation Release
Overlaps_Gene T10G3.6 Source_evidenceePCR338WS150 Sequence/Annotation Release
Chunk_score Abs_score254
Max_abs_score254T10G3.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1350021913501321
Overlaps_transcriptT10G3.6 Source_evidenceePCR338WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10G3.61103gattccctctgatttcttttcgtctcttctctctcgtctggcaacgatgctccgttttgacgcagtgcgccttgtttataattagttttgaatattattttttcattaattttctgaatctttgcaattcttcgacgatttaacataaaatggttagttttccttttaattttgtgatataaattgaaaaagtacatactcaaattattaaatgtgttataaaactgttggttgtctcggatatgaggctgttccgcttaaatgtaatttaaattaatggtttaggtatgtagaaagtcccgaatttttgttgtaactcacgaaatattactatttcagctgttcttctcattcttcaaatcactcgtaggaaaggacgttgtcgtggagctcaaaaatgatttgaggtgcggtttgttaaatcagtatatacaatttacagaaaatcgagaaaataactggaacccatgtaaaacttcaatttcaagacatttcttaaaaattggttcacaaaaaatgcttaaaacttcttgggttcaatattctgaatgtctagaaagaattcgaaactccccgaaaatatgtattagccagacggaaatcattttcaacgatacacttccacataatgaaaattccgaatttctcgaaatctctttaaacgcaagtgccattcctgggtttgaatttaaattatgaaattccatttaagattagttctgctaatttttataagttttgaagtttaaatctcacaaaattaatatttaaaaaataattatcttattctaatctctcaaatgcaaattctaataatttttcagtatctgcggaactctgcactcggtcgatcagtatctcaacatgaagttgaccgatatcaccgtctccgatccagaacgatttccacatatggtctctgtcaaaaactgcttcatccgcggatccgtcgtcaggtacaattagttatcatttttcataaatatttcaaaatgattctttaaaggtacgtgcaactcccatccgatcaagtcgacacacaactcttggctgactcctgccggaaggagcttctcgattcaaaggcaaaacagtaaatccac