Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T11F9.9   

sjj_T11F9.9 RNAi (3)
PCR_productsjj_T11F9.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST11F9.9 Source_evidenceePCR848WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcriptT11F9.9 Source_evidenceePCR848WS150 Sequence/Annotation Release
WB_DNA_textsjj_T11F9.91130ttgcattctctgttgttgccgttctttcggtatgcattactcttccaatggttcatagctatgttcaccatgtcaagagaaccatgaatcaagaggttcaattctgccgtgtaagtttgttgtttcttaaatttatttccagtgtttttgcttagggatccgctaaagatatctggtctgaggtcaaccaactcaagagcatccaacacgccaacagaaccgcccgtcaagctggatacgatgctggagtcaatggaggatctgcttccgctggaggatgtgatgcttgctgcttgccaggagctgctggaccagctggaacaccaggaaagccaggacgtccaggaaagccaggagcaccaggacttccaggaaacccgggacgcccaccacagcaaccatgtgacccaatcactccaccaccatgccaaccatgcccacaaggaccaccaggaccaccaggaccaccaggaccatcaggagatgctggaagcaacggaaacccaggatccccaggacaagatggacaaccaggagcaccaggaaacaagggtccatctggacaaaatggaaacccaggagctccaggagcaccaggacaaccagggcaagatgcaccatccgagccaattactccaggagctccaggaccacaaggagccccaggaccacaagggccaccaggacagccaggacaaccagggcacgatggacaaccaggagctccaggaccaaagggaccaaatggaaatccaggacaaccaggagccgatggaaatccaggagcaccaggacaatctggaactccaggaggagtcggagagaagggaatctgtccaaagtattgcgctatcgatggaggagtcttcttcgaggacggaactcgtcgttaatccaatcatttttatatcaaataaaaattttctaaactcagattatttctatttattagacaccaaagacagttgcaaataatattttagaatttttttcagaatctcgcggtttttgaaaactgtttcattcgagagacaatgttgaaaaacagttaaatgtgaatttttagctgtgaaattaatgaactgagatttttgaaccaaataattcataaaccaaccaaaagagcatgg