Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T11F9.9   

sjj_T11F9.9 RNAi JA:T11F9.9
Simmer:T11F9.9:Repeat_a
Simmer:T11F9.9:Screen
PCR_productsjj_T11F9.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST11F9.9 Source_evidenceePCR848WS150 Sequence/Annotation Release
Overlaps_Gene T11F9.9 (3)
F55C10.3 Chunk_score Abs_score337
Specificity_index0.108
Rel_score0.429
Y54E10BL.2 Chunk_score Abs_score284
Specificity_index0.091
Rel_score0.362
EGAP7.1 Chunk_score Abs_score315
Specificity_index0.101
Rel_score0.401
ZC513.8 Chunk_score Abs_score94
Specificity_index0.03
Rel_score0.12
F08G5.4 Chunk_score Abs_score169
Specificity_index0.054
Rel_score0.215
F30B5.1 Chunk_score Abs_score436
Specificity_index0.14
Rel_score0.555
T28F2.6 Chunk_score Abs_score291
Specificity_index0.093
Rel_score0.371
F55C10.2 Chunk_score Abs_score407
Specificity_index0.131
Rel_score0.518
Overlaps_transcriptT11F9.9 Source_evidenceePCR848WS150 Sequence/Annotation Release
WB_DNA_textsjj_T11F9.91130ttgcattctctgttgttgccgttctttcggtatgcattactcttccaatggttcatagctatgttcaccatgtcaagagaaccatgaatcaagaggttcaattctgccgtgtaagtttgttgtttcttaaatttatttccagtgtttttgcttagggatccgctaaagatatctggtctgaggtcaaccaactcaagagcatccaacacgccaacagaaccgcccgtcaagctggatacgatgctggagtcaatggaggatctgcttccgctggaggatgtgatgcttgctgcttgccaggagctgctggaccagctggaacaccaggaaagccaggacgtccaggaaagccaggagcaccaggacttccaggaaacccgggacgcccaccacagcaaccatgtgacccaatcactccaccaccatgccaaccatgcccacaaggaccaccaggaccaccaggaccaccaggaccatcaggagatgctggaagcaacggaaacccaggatccccaggacaagatggacaaccaggagcaccaggaaacaagggtccatctggacaaaatggaaacccaggagctccaggagcaccaggacaaccagggcaagatgcaccatccgagccaattactccaggagctccaggaccacaaggagccccaggaccacaagggccaccaggacagccaggacaaccagggcacgatggacaaccaggagctccaggaccaaagggaccaaatggaaatccaggacaaccaggagccgatggaaatccaggagcaccaggacaatctggaactccaggaggagtcggagagaagggaatctgtccaaagtattgcgctatcgatggaggagtcttcttcgaggacggaactcgtcgttaatccaatcatttttatatcaaataaaaattttctaaactcagattatttctatttattagacaccaaagacagttgcaaataatattttagaatttttttcagaatctcgcggtttttgaaaactgtttcattcgagagacaatgttgaaaaacagttaaatgtgaatttttagctgtgaaattaatgaactgagatttttgaaccaaataattcataaaccaaccaaaagagcatgg