Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T11F9.9_f   

sjj_T11F9.9_fSequenceTTGCATTCTCTGTTGTTGCC
PCR_productsjj_T11F9.9