Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T12A2.7   

sjj_T12A2.7 RNAi JA:T12A2.7
Simmer:T12A2.7
PCR_productsjj_T12A2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12A2.7 Source_evidenceePCR675WS150 Sequence/Annotation Release
Overlaps_Gene T12A2.7 Source_evidenceePCR684WS150 Sequence/Annotation Release
Chunk_score Abs_score579
Specificity_index0.417
Rel_score0.714
Map_statusTop50_percentile_ePCRIII62448116245999
T12A2.8 Source_evidenceePCR916WS150 Sequence/Annotation Release
Chunk_score Abs_score811
Max_abs_score811T12A2.8
Specificity_index0.583
Rel_score1
Map_statusBest_ePCRIII62448116245999
Overlaps_transcript T12A2.8.1 Source_evidenceePCR916WS150 Sequence/Annotation Release
T12A2.7 Source_evidenceePCR684WS150 Sequence/Annotation Release
WB_DNA_textsjj_T12A2.71189caatttgagcgccttgatttgttttctgttatcactgtcgatttgtcgattttccatttccattctgaaaagttgaataagtaattaaaaattagaacaaagtattttgtcttacctataattattggtaaccatgctgacccatgactgttccaattgttttactttttctcctgccttcaactgtgccatttttcgattcgcatgaacttccatgacggcttctttcgtttttcggagttctttctcggcatgtgttagaagatcttccataactttgtttctctgaagataactctcagcagcgtattcatccataagttccagattgatctggcgcatcagaagatgctcattttgagcttttgcattgcgaagaacctgaaaacgaatattatgatgtattttttaattagtagttgcctttattgattcattgaaatttatctactaaccttcgcccaaagttttctatcaactcccttaacagcagatggagcaggaagttcacaacgactcatatccaactttcccatctcttctttctttttcattcgatccatttctttgagcatacactttgtgagaaaagcatcatagtcgggcactggaagatgtgtcaagtaatttttcgttggacggaatgtctgaaaacattaaattttccatatatggcggaattggcagaagtaatgaaccttgcactcatgctccacaagtttcattgcgagctgtcgatccgcctcgttgtactctgtgtcaaggtaaggaagagcatcgacaagaacctgaaaatagtcattttacactgaaactagtagtttaaactacttaaaaacttggataggtggataaaattgattttagaatctcaaaaatatttacctgatcatcctgcaactgactagaaccacttccaccggtaagtgctaacggtttggagctcatcacgtgaacctgaaattgttctgtcgaaataatgaacttctgagattagagataaagattaacatgaattaacacttcgaaaataaaaaccaagaaacattgactttttgaattatttctcaatcaaattacttgtgttcaatcaaatcatattacaattgagacgagcaataagcaaaaaaaagtcgaatagaaactattacggccggatttaaaaaaaagaagttttcaacgggaacca