Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T12D8.7   

sjj_T12D8.7 RNAi JA:T12D8.7
Simmer:T12D8.7
PCR_productsjj_T12D8.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12D8.7 Source_evidenceePCR526WS150 Sequence/Annotation Release
Overlaps_Gene T12D8.5 Source_evidenceePCR10WS150 Sequence/Annotation Release
T12D8.7 Source_evidenceePCR526WS150 Sequence/Annotation Release
Chunk_score Abs_score463
Max_abs_score463T12D8.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1362375313625394
Overlaps_transcript T12D8.5.2 Source_evidenceePCR10WS150 Sequence/Annotation Release
T12D8.7 Source_evidenceePCR526WS150 Sequence/Annotation Release
WB_DNA_textsjj_T12D8.71642gttatttttgtggggaaatccatataattgcattttcagaaagaaaaatggcagatacaggagaaaaagacacagaaacgacggcaagtggtaccgatggacacagtaaagaggcgcttgctgtaataagcatgctccacgagtgtggaattcaagagtttgatccacgcgtcgtttcaatgcttatggatgtgagaaaatacaaaattgagctctaaaaattcaaaaaataatgattttttccaggttcaatacgcagtgacgtcaaaaatcctccaaatgtcaagtggactgtccaggcatgctgaaaaagcgcaaatcgaggcagaagacgttcaaacggcggccgacatgctcggcgttctgaccacaaacgctccggaccgtgagaagattctgcaattggcgaatgacaaaaatcagcagcccctaccgcaaattcgacacaattatggcctgaagctgcccaacgatcgattctgtcaattacagcagaattttgtgtacaaagctgacgacagttatcagccgtacgttttttttctcgatatatcttgaaaaatctgtaaaaatttgattttaaacggaaagaaggtattttaaagtggagtacgaccagtggggaaactattaaaaaccattcctatggttcaaaaatgacaaaataacaataaaaactcacaatagaacttttaaaaaaattatgatacttttccttttttacaccgcatttttaaatgaatattcaaaacattgaattattcaaatttaattctcacgtgaatcattttcaggcttatggggttattcaagtaatgtagcaaaatgtatttaaatacatttgtgacgtcacaaatgtatttaaatacatgtttttatatacttgaatacagttgtgacgtaattaatctacactttttaattttccgacactacttgaataaccccattagaaaacaaaattacagaaaaagttcacatttttatccaagaaaatgttccagaaaaatgcggggtagaaaaggaaaagtaccaaatttatagaagattttttgtttcaagtaaaaaaaggtgttgtttggagccacctttcgagaaatcgaaaacactttcgcattttcgtgcccccaaaataattaaatatgaatgcataagacatggaataagttttttttaatcgataacttccaaaaacatttgttaaaaactaagttttcaccgctttttgagccgaaatataaattttttccgaaattttcattctaaaaatttacagaaattctatatttaaacttgtcgattttcaatgctttttgtggctactgtcagtttcatttgaaaaatattgattcaaatttgcattttcatctcaaaaattgttttttcgaatcaaaaatacaaaaccttgacacaaaactaaaagtcacatattttccgacaatattccatttagttattgtttttaaatctttatggcatgcgttttttttttctgtagtaaaatgaaattatacatatcaaattcaaaattttcaagttttcagaatggaaatgcaacaagtcacccatcagccacatatcatcgaaccaccaacacaagtgctacggccggagcatgtacagaatatgctcaagcgaagag