Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T12F5.5   

sjj_T12F5.5RNAiJA:T12F5.5
PCR_productsjj_T12F5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T12F5.5a Source_evidenceePCR1019WS150 Sequence/Annotation Release
T12F5.5b Source_evidenceePCR1019WS150 Sequence/Annotation Release
Overlaps_Gene T12F5.5 Source_evidenceePCR1019WS150 Sequence/Annotation Release
Chunk_score Abs_score998
Max_abs_score998T12F5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI37349033736096
Overlaps_transcript T12F5.5b Source_evidenceePCR1019WS150 Sequence/Annotation Release
T12F5.5a Source_evidenceePCR1019WS150 Sequence/Annotation Release
WB_DNA_textsjj_T12F5.51194aagtttggtgcaggccatactggaggcggtggaagatccgttggtgtaggaacatgatatttcggattgcgaaccgatgtttgtggaggtgtacttgatccagagttagtcggagtttcgacagcatccggagaaaagtatttggagctcgtactcgatgaggaagatgatgatacagttggacgattattatagccattgtgctgttgtttacgttgacgggtttgcccatcatttcccgaccaccaagaattggaagattgcccattctgataatgattatgatgtccattttctccgttttcacgttgttgaccattttgataatgattctgtcgattgttatgttgctgataaccataaccattcgtcgttgctccatttcgattgtttccacgccatcggccattactcccattactttgccgtccgttattttcactataattattctggaatcttccaccattaccaccaccacgagaacgccattcatttgaattcgagaagctgctacgtgactcataatattgatttccaccattcctgcttccattgcgattattataattcgatgttgtggtgtgagtggagtttgacgaggcagtcgacatttcatcatagttccgtggcgtcgtcgagacacttgatccgtagtaatatggttgtggagtattttgaagcagaggtggttgttgttgctgctgctgctgctgatgttgctgatgatgctgtggtggtagaggaggcacaggaggcatcggaggattgtatgacaagctgtttccagagaagcggaacgtcggtgtgatgtactcgaagtggctcgaaatcgggtctccaggtcggtaagtggccacaggtacaaacccataatcagaaagcgtttgccccaactctcgaagatgtactgtgccctgctcgccgttgcccagtgtcgtcatttgtccattctctgaatgtggcgtctcttctggtgggggagcaaatgtcgaaggaccgcaagtttttatacgtgccttaaaattttttgctcgtttttagaaataaaattcaaaagtatacatagcagcatgagtggggatttcgcttttaaaaaattaaaaaatcattttggaattttaaattatgattggaaaaaaaattaaaaaatcgttattcaagttggatttttctttctttcgcgatttttcg