Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T13F2.10   

sjj_T13F2.10RNAiJA:T13F2.10
PCR_productsjj_T13F2.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST13F2.10 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (32)
Overlaps_transcriptT13F2.10 Source_evidenceePCR405WS150 Sequence/Annotation Release
WB_DNA_textsjj_T13F2.10827aaacagtagagttcgtgagcctggttttcttcgtttgttttgtgtacattctttgtatattttcgagtcttatttcagctagttaacttacatttaagcatggaattcaagccagctgatcaagaggaaaagctcaagtgaggcttcattttgttttaagaaagaacaagcatgcataaaaaactcatttatttcacaaggactctatgggttgtactcaattgggaggttcttacgacgagccataccgtctccctggaaccattcacgacggaattgcttggcagcaccatccggggtgttggtccactcaacagtgatacggtcgttgttggtatcctcttgtccgaaggcgaaggcatcgcaggaaacagcaagaagcacagcttcctttgggtcgagaactccacatggtggatcaactccaagtctcttcatattggtggtcttgataccatatccaatacgacgagccgatgagttgatcaccttgatgtggtaggtgtgcttgtcatcgtatggcgcattgaagacgatcttggtacccggttgggtttggatgtctcctggtgggacggattgggccatggtagttcgatgaaggagttatgagaactctatgaagattatggcaaaatcttccaaatttatagcagccttcttatctctgccctaaatctgaaagttcatccaaaaataggagatcacgttaaaatttgaaaaaaaatcagttttagctagtagctattttgaataattacatcaatttacacttgttctgatacctttgagtaacaaaggaaacctattcgttttctgtgagatgc