Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T14B4.7   

sjj_T14B4.7 RNAi JA:T14B4.7
Simmer:T14B4.7
PCR_productsjj_T14B4.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T14B4.7 Source_evidenceePCR1053WS150 Sequence/Annotation Release
Chunk_score Abs_score990
Max_abs_score990T14B4.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII67103516711679
Overlaps_transcript (5)
WB_DNA_textsjj_T14B4.71329ccacgacttccaccatatccgtcatcactgttgtagtcatcggcacgaatgcgtggctgtggtcctggattgatcaaaagaatactatcaacgttttgacagacacagactcctggctctcctggaaatttcaataagttttggaataaaaatagttgttcaagactcacctggtggtccttgtcctcccattggtccttctggtcctggatatcctggctcaccagattctccagaaactcccggccatcctcgttctccttgtcctccggtcaatccgtttcttcctggtaatccaggcattcctggagctccaattggtcctggtggtccttcgtctcctggtggtccctccttcaagtcaccttctggagttggtcccttatctccaggagctcctggtcctcctctgtatcctggtggtccagttggtccagtctctcctggtgctccgtcttcaccatcaattcccttaagtcctggtggtcctggtggcccaacatctcctgggaatcctggccatcccttgattcctggtggtccctttggacatggacggcacggtggtggctcacgaacttggttgagtgggcatgtttgatttggagtagttcctggcattcctggctttccagcgtttcctggaagtccaggttttcctggtgttccagatgatccacgtggacctggtggtcctggaatgcaacatcctggacattcagtttcaagtggagctccagtgatttcatctccataggctgttggtctgaagccatgtgaagctccgctaccataggcaccacgagcggtacggtttccagtcattctcatcttgccgtattgaagttcaagtgcagcctcgtcgtttgatctctgaagagttgaaaaaaattttatacaatagaaatataaaaatcttacttcgcaataagccatttctctgtcgacataggtaatagtattctggacatgattgtacataattgggagagcaacacagacaatgatgaatgaaaataagctaaatccgatttgaagaccggtgacacaccggtagatcatctgacgcgaatagttcgttgtcagcgagaacgttcgatagctgaaaaattaattaatttattcaatgaatcgggcgagatgatgactctgaattagtaaacatagtttctctattagtattgcgcccctattggagttgcactcaaattgattgatcggaaaatatacttgaatgccatacatagagaaaatagggtaatattaaacaataatttgagacaaaaatttttagaccaaaaaaattggttgtctgattgtctgcttccg