Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T14D7.3   

sjj_T14D7.3 RNAi (5)
PCR_productsjj_T14D7.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST14D7.3 Source_evidenceePCR309WS150 Sequence/Annotation Release
Overlaps_Gene T14D7.3 Source_evidenceePCR309WS150 Sequence/Annotation Release
Chunk_score Specificity_index1
Rel_score1
Map_statusUnique_ePCRII88586108859794
WBGene00044062 Chunk_score Abs_score225
Max_abs_score225WBGene00044062
Overlaps_transcriptT14D7.3 Source_evidenceePCR309WS150 Sequence/Annotation Release
WB_DNA_textsjj_T14D7.31185aactaactgtgacgtgggaaaaagaaatagattcgatcgaggttccagctatttctacttttttttatagacaattgatcagtgattcagcagaatttgcatttgaattcagggttgatgaatgaatgggtcacacgatgaaatgatggaaaacatggaatgtcttgggacaaaaaataaacatcgttgagttgtcaagtggattaatgatttggttggatcagaaagtgatgtttttctgaaaaggttctggaaaattacaaggaagaaaacaaatttagaagttagtattcacaatagtggcaaacaacttaaaatattttgttcgcaattttggaaaatctgaaagaaaactttaacaaacaaaaatgttttttttctaaattcaaaactttattcaatacatagaggctgttaaatcaataaatcatattgatatatgaaattgaacattcagagaaatgcgtatgcgattccggcaaaagcagacacacttgatacggcgatgataccattacgaatagcattggctttccagctcatctcacgcttgatctaaaaatttaaattaacttgttgtttatttcaatttttaaataccttgacagcacacttgacgtaaacatctgaagcttcctcgagtttttctgaaattaaatcttaattttttacttctaataaattaatttttttgaaaccaaaactcccagtttatgaaacttacgagctctttcaacgagatcgtcaagttttccctgtctctccataattttttgcacgttctccttcatgatgattttcacctaaatataattgttcatttttctaatgataaatgtcaaaccgaattcaattcctgtcttgttctcataatcttttgatcgtcccaaccaatacgactcactggtagttgttgatgaatcatgaagtaattagcgtctgctgtttcagcaaataaaatgtattgatactttttgaaattaattcatttttgttggaatgatggcacgtgtgttttctaaccaacaagattttcacggggcattaatttatgatataagaattgtatattttagaactctttaatttttcgagacctttcatgtagtacaagtgtttgaaaaaccctataagtagaaatactctaaaacatccttcctaaacaaacttttcccaattatcggt