Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T14F9.1   

sjj_T14F9.1 RNAi JA:T14F9.1
Simmer:T14F9.1
PCR_productsjj_T14F9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T14F9.1 Source_evidenceePCR942WS150 Sequence/Annotation Release
Chunk_score Abs_score823
Max_abs_score823T14F9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX22379732239166
Overlaps_transcript T14F9.1.2 Source_evidenceePCR942WS150 Sequence/Annotation Release
T14F9.1.1 Source_evidenceePCR942WS150 Sequence/Annotation Release
WB_DNA_textsjj_T14F9.11194tcgaggctcaggaggtaagaaaaacgttattttcactttgattttccgataatttgtgcattttcagctccgtaacaataagccaaactggggatcttacttccgctctcaaatgattcaagaagacgactacaacttcatcaccagctttgaaaacgccaaggtgagattatttaatttaacaactgtgaaaattgaatatatgtataaattttagtcgaaagaagagcgtgaccaggttcttgccgctaacaatgccaatggacaggcagctaagaccatggcaaacctcatcactcaagtcgccaaggatcagaatgtacgatatgtgcttactcttttcgacgacatgcttcaggtaagaatttacaaaggtcttgtgatcaataatagaaaaaatattcaggaagacaaatcccgcgtggaacttttccactctgcggctgctcgtcagaagcgcaccgtctggtcgcaatatcttggaatcttgcaacgacaagataatttcatagtcaaccaggtattttttgggtgttaaatgttttggcattaattatgtcgtaatccagatgagctccatcattgccaagcttgcctgctttggaacaactcgcatggagggacaagatcttcagtactacttctccttcctcaaggagcagcttaaaaactctacggtaagagtttaagtttgcaattttaattttatgaatttaaagtttcagaccaacgactacatgaacaccactgctcgttgccttcagatgatgctccgtcacgatgaatacagacatgaattcgttgattctgacggagttcagactcttgtcactgctctcaatggaaagaccaacttccagttgcaatatcaacttatctttgctgtttggtgcctcactttcaacgccgacattgccagaaaagctccatctcttggacttattcaagctctcggagatattctttccgagtccacgaaggaaaaggtcatcagaatcattctcgcttctttcgtgaacattttgagcaaggttgatgagcgtgaagtcaagagggaggctgctctccagatggttcaatgcaaaactttgaagactttggagctgatggatgctaagaaatacgacgacccagatcttgaggatgatgtcaagttcctcactgaagagctgaccctttcagtgcacgacttga