Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T19B10.2   

sjj_T19B10.2 RNAi JA:T19B10.2
Simmer:T19B10.2
PCR_productsjj_T19B10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T19B10.2 Source_evidenceePCR709WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusBest_ePCRV1122438311225279
T19B10.3 Source_evidenceePCR247WS150 Sequence/Annotation Release
Chunk_score (3)
Map_statusBottom50_percentile_ePCRV1122438311225279
Overlaps_transcript T19B10.3 Source_evidenceePCR247WS150 Sequence/Annotation Release
T19B10.2.1 Source_evidenceePCR709WS150 Sequence/Annotation Release
T19B10.2.2 Source_evidenceePCR709WS150 Sequence/Annotation Release
WB_DNA_textsjj_T19B10.2897gtttcaaaggctatcgctcgtgaggccaactattgcctccaaaagaaaatcgctaacttcgctggagttccagacattccagatctcgaggaaggatcattccaatacaaagactcggtgtaagtgttccatatcatccgctaacatcataaccactgataaatcaattttaattcactaaaacaatcatctcttcagcatctcctctatctctgaccatatccttatccagtctcgtctctctttctgcggagaacgcaagccacaacgtgccgcatctacccgtaactgtcttgccagtccatttgttggatatttgagcggacactgcaaggttctcgccaattgtgatgctaagtttgttggacaatgcggacaaaccattccagccacacgcaaggccacttgcgaatgcatcactgaagccagagacgatttgaagaagcgtattggatccatcgccaatgtcttcaatgatgtaagaggattgagttgaactagagaatttgtatatttcccagtatattttaagcacaaatggaaacgttttggttgcttatttaaaaccagaaaatattttgtttcagcttctctccggaggacgtgggcttgccatcggatctgccaacaaggtcgatatttgtacatctcaaatcaagaaacaaatgatcactccagtcaacgattgggtcaatgttattgatactgctctttcctcatgcatccgtaacaagccagctggacagaatctcgcaatggaggctcttctcaatgttggatgccgtaaagttattgctgatacaactggagctgctaccactcaactcaagacaggattcgactttgtcaacaatcttattgatgcaatggttcagcgtagtggacgcttctgtggtg