Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T19D12.5   

sjj_T19D12.5RNAiJA:T19D12.5
PCR_productsjj_T19D12.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST19D12.5 Source_evidenceePCR858WS150 Sequence/Annotation Release
Overlaps_Gene T19D12.5 Source_evidenceePCR858WS150 Sequence/Annotation Release
Chunk_score Abs_score795
Max_abs_score795T19D12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII66351186636205
Overlaps_transcriptT19D12.5 Source_evidenceePCR858WS150 Sequence/Annotation Release
WB_DNA_textsjj_T19D12.51088agctcgtaatcttccaggcaaacggttttgtgtgtcgcttaccataacctccttcagctgtacaacttcttctgatttttcaagatgtttccatgggagttcaccagcaagaagttcgtaagcagtgtacataactgacacaagatcatcatacggtgattgctcgcaacggcggtgaactctgatagagacatagcgagtcgttccacgaaatcctgcgcgaagtctgggctctctccattctccactttccattttatatcttcgtacaagtccgaaatcaagaagaatcaatgtatgacgactctgaaaaataatgaatagttccccattacttggaaggttgattcatacatgaggaaaaattccaaagcacatgtttgctggcttcacatctctgtgaacatatcctgtttcgtgaagatcctgaagagcagcgataacctgatggatgattcgtccaactgaacattgactcaacttcttgttcggactgcttttcttgatatctccaacgttgatactcaagatttgcataactaaaagttaaattttagaattttcattctgaaaactgacttactgataaagttgtacttctccgcatgcccagatccataaatcatcggaacatgtggttttccttgcattttagccaaaacatgttgctccagaatcattctcttcgccagttttcctcttctcttcttcggttccactttaattgccacctcctctcctcgaacaacatccagtgccaaatatatctccccatatccaccttttccaatcaatccctcaatcaaccatctcttcataaatttctcgttcaacggcaaatgtcctggctcttctggatcaattttcttcattttcggcaagacttctttattgacaaacatcgtcttctcaacggtttttggatttaatgccattggtgtcgttgttacaggtgttggagcattatcttcttgtttcgtatccttcgacattatcttcttgtgatcttttttgttaatatttcgcaattcgaaacaaaaccatgaaatgattgaaattatcgaaaatcggaaaaagtagaaaacgcg