Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T20F5.2   

sjj_T20F5.2 RNAi JA:T20F5.2
Simmer:T20F5.2:Screen_A
Simmer:T20F5.2:Screen_B
PCR_productsjj_T20F5.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20F5.2 Source_evidenceePCR609WS150 Sequence/Annotation Release
Overlaps_Gene T20F5.2 Source_evidenceePCR696WS150 Sequence/Annotation Release
Chunk_score Abs_score612
Max_abs_score612T20F5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI39084863909598
Overlaps_transcriptT20F5.2 Source_evidenceePCR696WS150 Sequence/Annotation Release
WB_DNA_textsjj_T20F5.21113ttgttttcatgccttttcaagattttatttctgtcgatccagctcgagcttttcccaaagagctctttttcttctaaaagcacctaccgtatacacattcgtcgtcaaatagtgcgcattgggcgcgcacaccgaatattacgacaagatgcagaaatcatcatttttgcaattttgaagtttcaaccgcattcgaagtcgcttttctttccttttttctcactgaaagttgaattttattattttattattcttattttcagacgagatggctggtatgcacttcttggtgggaatttccaccgaaaactacgtgattttggccgcagacaaagccactttcgcttatggcgctattctcgctgacagcggtaaggctgagaatccgggatgcaaaaaatattcaaatttatattttagaaaacgacaaggaatatagactgggaaagaagttgacaatgatgtgcatcggagaggaaggagacgtcgcacagttcggagactggaccaagagaaatcttcagttgtactcggtcagaaatggttacgaggtttcaccatcatgtgctcatcacttcgttcggcgcagtatcgccgaaggtctccgctcgcaagatcactacactgtcgatgttctgattggaggatatgatgacaaggaggacaaggctttcctaggatctgttgattacttggctaatggactcgggcaacaggtattcagcaatttattatcttttagtcaaaataaagaattattattcagccgtacttgttccgaggattctgcggacgcttctgctatgccattatggatcgtgaatacaaaaaaggtaagttttaattaagtttaaattaatgttcccaactttactgaatgattttcagacatgactgaggctgaaggactcgctttgatgaacaagtgcatcggagaggctaagagacgtttcgtcgccaacattccgggatacaaagtggtgatcatcgataagaagggataccgcaaattggatgatgttcttttctaaatttctggccccggaatatatttttcaccggttattacacttctctcctgcaaccttttttgtgacttttctcccagttttc