Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T20H4.3   

sjj_T20H4.3 RNAi JA:T20H4.3
Simmer:T20H4.3
PCR_productsjj_T20H4.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20H4.3b Source_evidenceePCR687WS150 Sequence/Annotation Release
Overlaps_Gene T20H4.3 Source_evidenceePCR1058WS150 Sequence/Annotation Release
Chunk_score Abs_score995
Max_abs_score995T20H4.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII72398557241015
Overlaps_transcript T20H4.3a.1 Source_evidenceePCR1058WS150 Sequence/Annotation Release
T20H4.3b Source_evidenceePCR948WS150 Sequence/Annotation Release
T20H4.3a.2 Source_evidenceePCR1058WS150 Sequence/Annotation Release
WB_DNA_textsjj_T20H4.31161ttttcctttacagcgatgggagttcaagcatccaacaccattccttcgtactcgtgaatttctctggcaagagggacatacggcttttgccaacccagcagacgctgaaaaagaggttttccaaatccttgatctctacgcaggagtctacactgatttgctcgctatcccagttgtgaagggacgaaagagtgagaaggaaaagtttgctggaggagattttacgacgacagtcgaagcatacgtggcatgcaatggtagaggaatccaaggagcaacttctcaccatctcggacaaaatttctccaagatgtttgatatttcgtacgaggatccagcgaaggaaggagaacgagcattcgcttggcaaaattcgtggggtctttccactcgtaccattggtgcaatggtaatgattcacggagatgacaagggattagtacttccaccaagagttgccgctgttcaagttattgttgttccagttggattcaagactgagaacaagcaatcgcttttcgatgctgttgataaggttaccaaggatttggtcgcggatggagtaaaggctgagcacgatttgaggtttgaaattaataatgaatgcagttatgtacgtttttaattacagagaaaactacaatgctggctggaagttcaatcattgggaattgaaaggagtcccaatccgttttgaggtcggaccaaatgatttggcaaagaaccaggtaaccgctgtaatccgtcacaacggagagaagaaacaactttccctggaaggactgtctaaaactgtcaaatctcttcttgatgaaattcatactgctatgtacaataagttggttaaaatttttaaaagttgaaataaattccatacttcagggtactcgctcaacgtgactctcacctgaagagcaccacgtgcatcgaagaattcaagaagcttcttgacgagaagtgcattatactgtccccattctgtggtcgtccagactgtgaagaggaaatcaagaaggcatcaacaagagaagacggagaaggcgcacagatgggagccaagacgttatgtattccattggatcaaccaaaacaagaacttccatcaaaatgtcttttcccatcatgcacatacaatgccaaggctttcgctctgtttggaag