Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T21B10.7_f   

sjj_T21B10.7_fSequenceAGGACAAAATTCTCATCAGTGGA
Length23
In_sequenceSUPERLINK_CB_II
PCR_productsjj_T21B10.7