Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T21B4.12_b   

sjj_T21B4.12_bSequenceGAATTCTGCGAACCTACATCAAC
Length23
In_sequenceSUPERLINK_CB_II
PCR_productsjj_T21B4.12