Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T21C9.1   

sjj_T21C9.1RNAiJA:T21C9.1
PCR_productsjj_T21C9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST21C9.1 Source_evidenceePCR700WS150 Sequence/Annotation Release
Overlaps_Gene T21C9.1 Source_evidenceePCR700WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1057959210580769
Overlaps_transcriptT21C9.1 Source_evidenceePCR700WS150 Sequence/Annotation Release
WB_DNA_textsjj_T21C9.11178gtcaatgctccaagaccgattgaaacatacaaagcttcggttagccaagaattgctgaaagttatcatttggtacttttccgatttctgcccccccaaaatgttttttactcaatattttaatttaaattcacacgtaaatgtttatttcaatacaatttcaatttttaggcttatgggatgatgcaagtgaatttctcgtcatttctcgacaaatttatttaccaaaatttcaccaaaaaaatttatttaccaaataataatatttaattttttttttctgtccagtcagattttaataataaaaatcgcgaattttttaatttccgattaataaaacttactttctcggatccaaaagactaagtggtttacgtggtgttctcggtacatcgtcaatgatggaatgagtggaaggagcataggaagtaacactttgagcatcttcttcttcgtaaacttttccacgaattctgaaaatcaataagaaataaattcagaaaaattttaaaatttacctttctataacagccgaaagtccatgagacgtcaaacggctttttgattccgaatgcgacatcgactttggtgtgtctgtattattctgagtactacgagtctgtggagtgacttgaggagtaattgaaacagaagcagttggagtttgtgttcgatcttcttgaagatgtaagtattctcgatcaatcaacattttagccacatgaccgattttaacacttcgaaatacttccacagcttcatcgtgtgtcttgtaggtcatatcgataccgtcaaactaaacattggaacaatttaaattaataattactttaatcggaaactaaccgacaaaattttatcgcctgttcttacgactccatatgattttgactcgctattaactgatgagacgtatattccgatatctccaacaaagtgaggattgtctgttccaccaactatattgaatccgaaacctgtaaaatgagtactatatagacgtttaaaaatacaatttatacctttagatgttttttctatttcaactactgtcaatgcctccaatggaacagattcttgtccatttccatctgtagtcgtatcattgaatgtcatgtcgtccgttgcttctgcagcaaatgaaatatcgaatgtatgatcttcatcagcgtgaaatgg