Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22A3.4   

sjj_T22A3.4RNAiJA:T22A3.4
PCR_productsjj_T22A3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T22A3.4a Source_evidenceePCR873WS150 Sequence/Annotation Release
T22A3.4b Source_evidenceePCR873WS150 Sequence/Annotation Release
Overlaps_Gene T22A3.4 Source_evidenceePCR873WS150 Sequence/Annotation Release
Map_statusUnique_ePCRI1059097910592634
WBGene00044070 Chunk_score Abs_score789
Max_abs_score789WBGene00044070
Specificity_index1
Rel_score1
Overlaps_transcript T22A3.4a Source_evidenceePCR873WS150 Sequence/Annotation Release
T22A3.4b Source_evidenceePCR873WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22A3.41656tgagcgaattctgtgcaaactgtcttcgtggtcctgctccaggagagaagcttcttcgttgtggtggatgtaatttctcaatgtattgtagtaaagagtgtcaggcaactgcctggttagttcataaaccagaatgcaaaagactgaaagctgtgggtttctaactaaaaattggaattaatattaaatttgagagcttcccaaatcttccactcactgaagttttgttcctttcaaaagttatcgatcgtattcagtttttggagaaaaatggagataaattgggaattgaggcagagaggaaattctcgagtttggttgaccataaggttgatatcaggtgagaataattgaaaaactggtgaataggatctttcaagagtcaaaaatcaacgattatgtcaatttaattagattttgtcgcgacttttcgtatcttttcagtataaatttttctagagcacgaaaacataccaatttactaaacgctaacgcgaaacgcgaaatagaacaaaaatcagaatacttttaacgaatttttcagcaaaattggaattttaactatttgtttagatggtattcttctaatattcgattaaaaaaataaatgttcttacttttgttcatgcttgttacaaataaaagccaaaatgaattatgaaaaatcatgaaaatacgaaaaatcgctaggaatctaaaatattaactaatagttaattgtccgagaggagtacacgcgcgagtgcactggagcactcatttgcgcgcgaaattcaaattagattaacgcggaggtcgattttcagcttttcgaagccatggaataggcgttttaagatatttgaaaaatatcaaaaacacaattttagagacgacgaggagaagatggctcattttgagaaaatcttcgagaaaatgggagccttccgaggagaggaaatgattgaaaaaggcgaattcttcgatgtattctgtaaggctacaatcaattctcacagtattcacacaaatgctggaaatgaagtcggaatggctcttgatttgggtgtttcaaagtataatcattcatgtcgtccaacatgttcaatggtttttgatggatatcgtgtatgtcttcgaccactggttccaggtgttgatgctgaaaatactgaagaagcattcatttcgtatattgatgtgggaagaagcaagtatattcgaagaagagatttaaattcaagatggtattttaattgtgaatgtacaagatgtatggatccagaagatgatgcattgacagctattcgatgtgcaaatccggcttgtgatgctccaattgttagtttttttttcaaaatctaaacgcttttgcaggaaattcaaatgttcaattcgatcggtcgatctagtgttacaattttctgaaacgtatacttagagtactgtagctgaacagtttcgctcgtcacgagacccgagccctttgaattggcaacaaaacttgctctagaacttaattcattttctgaagaatcaaagcgaaattccagctaacatctgaaactgaagaaccaatgaacattgcttgtgaaaaatgcaaaacgattgtcgaagaggatactgtaaaagcagctcaagaatacatgaaaacccttccagcatcatttgatccaa