Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22A3.6   

sjj_T22A3.6RNAiJA:T22A3.6
PCR_productsjj_T22A3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST22A3.6 Source_evidenceePCR815WS150 Sequence/Annotation Release
Overlaps_Gene T22A3.6 Source_evidenceePCR815WS150 Sequence/Annotation Release
Chunk_score Abs_score731
Max_abs_score731T22A3.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1059695710598020
Overlaps_transcriptT22A3.6 Source_evidenceePCR815WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22A3.61064ttcaaccatgtcgtccttcaactgaaacatcatcagattttgtatgcttgaatcgagatggcttcccgtatactgattatgatatgtctgatattctcgatcttccacagttgattggaatatttaaagatgttgatttaatgtatgagtcgagatttgttctgccaagtttgccagatggagttcagagattatctacaaagaggtaacctctaaaatttatagtttatagaaggaaacttttctaaaagtttgttggattttttcattgtcgtgccaaagttttcaaccggaaatttatacagctgcataaacaaaggacacattgcaaaccactttggaccttggatagctgttctcgatcagactgcaacccaatttctggctgccgctggaaggaggtaatcgagaaaaaaaaagttttttgaatttcaaataaccaaatactcttctttccagaaaacttcgagatctatgttttccgagttttaatgaacatgaaatattcacgtatcaacaaggaatcttactcgatgcaataattgaagatgaactgacaatatctggatgtacattctggagacgatgcttctcatcatgtcaagatgacttggcaacttgttggctgaaatctcaaaaaggatattttgggtcaaaagctaccagtgtcagtgggaaacagtgtattccatggactcaagccacgtcggaaatattgagtatggtcaaagtgaattccacgtcatcaggtgtctatcatatgtaccatcggcttctttttgaggatcccagtcaatttttcactgaaagtagacttttcatgaatactgagttagtttatcttttaagtaggagagcagaaaactttattttcagagcctcttgtatgcttctgaaccggagaaactcagtggaagttaagaattcatacaaagaatcaccattttttacgaacgagaaattggtttcggaatttgaaaaattattccaacaaggtcctggatgctttgtcaaacaggtattggaaatcagtaatttttgtgaaacgtggtgtataaaggcgc