Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22B11.5   

sjj_T22B11.5 RNAi (6)
PCR_productsjj_T22B11.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST22B11.5 Source_evidenceePCR891WS150 Sequence/Annotation Release
Overlaps_Gene T22B11.5 Source_evidenceePCR891WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIV47007404701630
Overlaps_transcriptT22B11.5 Source_evidenceePCR891WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22B11.5891tgagtggatcacgcttcttgaagaaatcatcccatggagaatcgagccaatctctgttacgaacatatgtcaccttctgcgcattctcataagcatcctcgagaatcgacccgtactttgtgagttcttccttaacatattgctcatttgcaactccttcgttgagaatcttctcctgatacttttccagtgctgtcttcgtttgcttgattcgttggtacatgagtggttgagtgaacatcggctcgtcgagctcattgtgtccgtgacgccggtaacaaacaagatccacgataacgtccttcttgaaagtcttcctccaatcggcggcgacattgcacacgtgcattacagcctccggatcgtcgacgttcacgtggaagatcgggcatccgacgacacgaccaacatctgtacaatatggagacgagcgagaagatcttggatcggtagtgaatccgatttgattgttcacaacgatgtggatggctccgtgagtcgtgtaactcggcagatcatccaaattgaacgtctcgagcacaacaccttgaccggcgaacgcagcatctccgtgaagaaggatagccatcgtccgatcgcacttctcatctccagcatagaaagcttcagctcggacctttcccatcacaactggatcgacagcttccaagtgagatggattagcgacgacggcgattttaacgttcttctgtgattgtctgttcaatcgttcgatgcagactcccaaatggtacttaacatctccggatccttcatcagcaggctcgagagtcgagaattgcgacagaatcgtggccagtggctgacggcaaacgttggcaagcacattgagccttccacgatgtggcattccaatgacgaatgagtcga