Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22C1.10   

sjj_T22C1.10RNAiJA:T22C1.10
PCR_productsjj_T22C1.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T22C1.10a Source_evidenceePCR763WS150 Sequence/Annotation Release
T22C1.10b Source_evidenceePCR763WS150 Sequence/Annotation Release
Overlaps_Gene T22C1.10 Source_evidenceePCR815WS150 Sequence/Annotation Release
Chunk_score Abs_score773
Max_abs_score773T22C1.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI79714697972336
Overlaps_transcript T22C1.10b Source_evidenceePCR763WS150 Sequence/Annotation Release
T22C1.10a Source_evidenceePCR815WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22C1.10868tcacctgcatcaatccaaaactgcttatcgtcaagatcaattcgcaatccttgcttcacgccaacctcttgtcaattttcacctggtgctccatcatcaacacctggctcttgctcttcgactacaactaacaactggacttcgtttccatcctttacgcaatttattctgtgtaactggtaatcgagcattctttgcttcactcgattcacatccactcattccattggatcgagtcgatgatgctacaatggagaaacgacacgcttttttggttaaagttgcagaacaaggaagtatggaagaacgacgattggctagacatttagaaatggaatggaaactgacagtcaatgaaatttcgttcatggtaattaatttcacctaggaaattttgaaaataatatttccaaattcttccagcaagcattatcgtccttccgtcttggcaatgatcatcaaggatccttggaacttgcatcttgtgttcgggacgatcgatcagcagttgcactggcacgtgttcttgctgctagacttattcaacttgcaaatgaagcgaacaaacgatacagtactgctcattctcaatacctatgtgcacttgctggggaagaagctgctcgtgtagagctttatgaaaactctccagatgatcctttagtcgacagtaatccaaaaacctggaaagatgcagttacatcacttggaagagctggaaactcggtaccacaatcggcgcaggccgccattccatttgttcgaatgaatgatattgccaaactatatttcggagctcagtgggtgaataattgatttattgcattatttttcttatgggtttcatgttttcgccgtcttcttttgt