Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T22D1.4   

sjj_T22D1.4 RNAi JA:T22D1.4
[cgc5655]:daf-2:T22D1.4
[cgc5655]:T22D1.4
[cgc5655]:tph-1:T22D1.4
[cgc5655]:tub-1:T22D1.4
PCR_productsjj_T22D1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST22D1.4 Source_evidenceePCR1006WS150 Sequence/Annotation Release
Overlaps_Gene T22D1.4 (3)
Overlaps_transcriptT22D1.4 Source_evidenceePCR1006WS150 Sequence/Annotation Release
WB_DNA_textsjj_T22D1.41107atttctgctggaatcgatggaagcaaaggaaaattgaaaatttctgaaaaaccagccgaaaaggatcttgcagtttacgaagtagacctccgaactcctgttgccaagggagccaaagttaccataagaatcaatcttcgtatcacacaagtacttgagccactcccatccaagattcagcaatctgacagtcaatttgttgttcttcacacatctgcatacgttccttccctgtacgaaactgtgacccaaaaaacaactattagaaccactcaaggaggcaagcttctatccgcaaccacagtttctccatcgaaacaagaaacggaacgtgtcatctacggaccatatgttaatatcccagcttttgagacgaaaccagtcaaagttcattatgaaaataactcgccattcgttattgccaccatcgtggaaagattcatcgaggtttctcactggggaaacatcgctgtggaggagtacattgaattggttcacaagggagctgagcttgatggtccattctcaagaatcgattaccaaatggaccgtcgtggacgtcgccaaccagcactccaacagtttaccacagttcttcctgctcaagctaaagatatctattatcgtgatgagatcggaaacatttctacatccgctgtacgaatccgtgctgacagcgttgacgttgagattcgtccacgattcccactctttggaggatggaagacgtcgtatgtcatcggatacaatttgccatcggaagagtatttgtacagcaaaggaaatcagtatgctctcaaaacaaagttgttcgatcatgtgttcaatgatattgttgtagagaaattgcgcactaaagttcttcttccagaacatgtcaagtaagttttcattttactcattgcgttagttttcaaaaaaagttattatgttggttaacatttccatttttaaatgctgaaatgattttctcttttttcaggcgtgtaaaggtggccactccatatgctgttgacagaagaccagaggagctcaagccaacatatctcgatactactggacgtcttgttcttgttctcgagaaggaaaacattgtgccagaccaca