Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23D8.1   

sjj_T23D8.1 RNAi JA:T23D8.1
Simmer:T23D8.1:Screen_A
Simmer:T23D8.1:Screen_B
PCR_productsjj_T23D8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23D8.1 Source_evidenceePCR773WS150 Sequence/Annotation Release
Overlaps_Gene T23D8.1 (3)
Overlaps_transcriptT23D8.1 Source_evidenceePCR773WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23D8.11489acgtcacattcggtgtttcaacaattgccaacgaagttgtcctttctccaaaaaaatgccctcatcatatgcatacaacaagcggatctcatttttcattgcctcttctcagtggacgccttcctgaatgttcattaacatgtgaagctgacaatcaagtaccaatgatgtttgatggacgtgttcgacgaattcttcgaatctggacagcagcatggtctgtggcatgtttcgtgtgctctttattcactcttgtcacatttcttgttgatttatcacgattcgcgtatccagttcgaccgattttgtatctcgcgttctgttatctagcaatttctacggtttatatgataggtgagttgaattttctgttttttttaaatcagattttttagaaactaaaaatgtatttctacaggcgtagtcggtgaagatggattcgcttgtggaacgtatggatctactccaacaacacttgttacgcaaggaggagaaaatgttggatgtagtgctcttgctgttgttcattactttttcttcatgtcaagttgtgcgtggtgagttttttcgttaatttttgtattttaacgaaaaaagtaccgttttttgtaccacaaatagaaaactggttttgaaaatgtgcattcgaaaaaaaatcggcatgtttttcttttgttcaaacacatttttcaacaaaaaaacgacaactgaaacattttttttttaaagaactttttgaatattttgataaaaattttaatttttataatttcgagtgtaatttttcagaaaaaaattacatttatgattttcgacaattttcagtaacaaaaatctaaaaaatattttttttaaaccaaattttaaatgaaaaaaaccccgtttccggaaaatcggaaaatcaaaaaaaaaattcaatttttatcaaattttgttcatgaaaaaaatgtattttttcttcaaacaaaaaaaaaacaaaaatcgaaaatttttgttttcattgaaaaatcgaaaatcgacacccaaatttttaatcttgatttaaacagctatcagcctttttaaaatgatattttatatactaagtattctttcaggtggcttgtactgtgtctagcctggttcctggcggcaaatctgaaatggggagctgaatcaattgctgctctgtcaccatacttccacgcaatgtgctggggagttccagcagttctctcggttactgtactagtgacaaattctgtcgatggagatgtatttactggaatctgttcagttggaaatttgaatccctctgctctcgtctatttctttttcactccgatcgttgtatcgttgggttagtttttttgtgaatattatggtgggggaagaccgaaattgaattcgtttcgttgtgtgttccatcgttatttatcttcgttttcttctcagaaatgttctatttgcagcactcggagcagttttactcgtttgtggaatttggtca