Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23H2.2   

sjj_T23H2.2RNAiJA:T23H2.2
PCR_productsjj_T23H2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23H2.2 Source_evidenceePCR708WS150 Sequence/Annotation Release
Overlaps_Gene T23H2.2 Source_evidenceePCR708WS150 Sequence/Annotation Release
Chunk_score Abs_score605
Max_abs_score605T23H2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64388506440373
Overlaps_transcriptT23H2.2 Source_evidenceePCR708WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23H2.21524ggctctggcaaatccaattaaaaataactatagttgctcaattattcgtttcagctatccccatcagagcttccatccgaacgtggaaacatctcgttcacattgagctatgactctcacactctaacccttcttgtcagtatcataaactgccgaaatctctgtgagatggtagtttctcgtgacggacaatgtctccttgatccatatgtcaagttacaactacttcccgaacgtgagcatcgtgtcaagacgcgtatcgttcgttcaaccaccagcccagtttatgaggagcaatttgcaatgtatggagtcactcacgagcaagttaactttgccacgttgcacttccaggtagagagcaaagggtttttgaaaacatgaaaggattttcaggtcgtcgcattcgatcgttactcccgagacactgtcgttggagaatgtgtctacagattggctgatgcagaacttcaagttcacaatgagatgaggtattattttgttttacagactttacagacttcaaatatttatatgctatgtttttctagagaaaaagggagaagatcgaaatgtagaacaaattagacaaaaaatattttaaacacccgcatgtcaaattaagaggctccgggtgacgtcacacgtttgaaaactcggtcacattgtttttataccaaaacagaattatcttatattgctttatcgttttttatcattttaaaaactattctttaaattttttattaacaaaagacatttgatgctaatttaaaattctccagagttgaactccctctcctcccacgtgccactgatactgtagctgctcgtggagagcttcttctctcattgacatatcaagctgcattcaacaatttgacagttgttgttctcaaagcccgtggactcggaggacgaaacgatgccggaactgcaggtatagactcttgattcctttttttgttgatttctcgcatgaacaatctcatgatcctcaatgaatgactgcagtgatctagaaaatgtttaaaaatagaacatttttccagatccatttgtcaagttatacttgcgcaaggaaagtggagaacgtatcgttaaaaagagaacacatgtgagaaggtctactttgaatcctgtctacaacgaatcgtttgtctttgaacttccagatgatagattggaacattctgttattgacttgcaggttagtgagaaaagggaaaaattatgaagaatacgacaaagtatcaaaccttcgcaactttccttctgaaaaacgtactttaagctgcacatatatatttgaatagtctcaccgcgaggaacagcttatggtagcaccacagaaactcacagaggactgcaaacacgccttataacactgagagtttaaattttgtgatttatgactaaaaaaatgcgtcacctggtcttgacacgactttatatttttaaattaaaataaatgtttccccttaaaaagtacagtagtttccacgactcgcagttcctttcgtc