Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T23H2.5   

sjj_T23H2.5 RNAi (7)
PCR_productsjj_T23H2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23H2.5 Source_evidenceePCR595WS150 Sequence/Annotation Release
Overlaps_Gene T23H2.5 Source_evidenceePCR664WS150 Sequence/Annotation Release
Chunk_score Abs_score580
Max_abs_score580T23H2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64572986458463
Overlaps_transcriptT23H2.5 Source_evidenceePCR664WS150 Sequence/Annotation Release
WB_DNA_textsjj_T23H2.51166tgaatacccggatgaaacatttacaaaaccaaattggagaatagagaagtaagagggaaaaacatgaatctagcagcatcctccactgctactctgcctctgtggttgcactggattcaccgtatcgcgggattgctcgtcagtggaatcaggcatctgaaaataaaaacaaattatgaaaaaaaaacaatcgtattaatgaaactaatttagattattctggtgcaatttttgacgaagcgattaaaattttttgcatgattaaaaacgaagaagtttcgctcttcatattttgtactagaagagtaatgaggacaaaaataaaaaggctcttagatttttcaactaattacgaacaatttcacaagaaaaaatcagattctaatgcatttagcaatctaattatcacattttcgtcgatttcaatactatcagaacatatattcgcccgtgcaaagaatgtactaatatatttcgaattttcacatccttaattttaatttttaaaaacattttaaaactttaccttagccagaattgcttctgctaaatcgtaaaacgctgtatcgacgtgaacattcaatttagctgaagtctcgtggaagctgaaaataaaaattgtttgagattatatatatatatttttttattttttaatcctttttaatctcccaaaacgtacctaataccatgatcttgtgcgatcttctctcctcgttctctgctcacaactcgtctatcactcatatcacatttatttcccaatatcattttaacaacatcttccgatgcatgttcgtcaatattgcgcaaccactttgcaatattgtcaaaacttttcgcatttgtgatatcgtaaaccagcataattcccattgctccgcggtaatatgatgttgtgattgtgtggaatcgttcttgtccagctgtgtcccagatttgtaatttaatcttttttccttttaattcgatagttttaattttgaagtcgattcctgaatgaaaaaagaaaattattttgaaatcactagattctgaataaaaactaaccaatagttgagatgaatgtggtgttaaaggcatcatccgaaaatctgtacagaatgcaagtttttccaactcctgagtcgcctattagcagcaatttgaagagcatgtcatacggt